Molecule Information

General Information of the Molecule (ID: Mol05814)

• Name: hsa-miR-516a-1 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  UCUCAGGCUGUGACCUUCUCGAGGAAAGAAGCACUUUCUGUUGUCUGAAAGAAAAGAAAG
  UGCUUCCUUUCAGAGGGUUACGGUUUGAGA

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Paclitaxel

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant glioma [ICD-11: 2A00.02] [1]

• Sensitive Disease: Malignant glioma [ICD-11: 2A00.02]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; .
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: IGROV1 cells; Ovary; Homo sapiens (Human); CVCL_1304
• In Vitro Model: MCAS cells; Ovary; Homo sapiens (Human); CVCL_3020
• In Vitro Model: OVCA429 cells; Ovary; Homo sapiens (Human); CVCL_3936
• In Vitro Model: OVCA432 cells; Ovary; Homo sapiens (Human); CVCL_3769
• In Vitro Model: OVCA433 cells; Ovary; Homo sapiens (Human); CVCL_0475
• In Vitro Model: PEO1 cells; Ovary; Homo sapiens (Human); CVCL_2686
• In Vitro Model: PEO4 cells; Ovary; Homo sapiens (Human); CVCL_2690
• In Vitro Model: TOV-112D cells; Ovary; Homo sapiens (Human); CVCL_3612
• In Vitro Model: TOV21G cells; Ovary; Homo sapiens (Human); CVCL_3613
• In Vitro Model: OVCAR10 cells; Ovary; Homo sapiens (Human); CVCL_4377
• In Vitro Model: OVCAR8 cells; Ovary; Homo sapiens (Human); CVCL_1629
• In Vitro Model: OVCAR5 cells; Ovary; Homo sapiens (Human); CVCL_1628
• In Vitro Model: OVCAR4 cells; Ovary; Homo sapiens (Human); CVCL_1627
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Based on miRNA expression and GI50 data, Pearson's correlation test identified 35 miRNAs associated with in vitro paclitaxel sensitivity (P<0.05).

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [2]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Advanced renal cell carcinoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: Blood samples from 38 patients and 287 miRNAs were evaluated. Twenty-eight miRNAs of the 287 were related to poor response and 23 of the 287 were related to prolonged response to sunitinib treatment. Predictive models identified populations with differences in the established end points.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K-AKT signalling pathway; Regulation; N.A.
• Cell Pathway Regulation: Cell cycle pathways; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Cell viability assay; Cell cycle assays; Apoptosis assay
• Mechanism Description: Our findings indicate that tamoxifen-resistant cells express miRNA-519a at high levels, which directly represses the expression of PTEN, RB1, and CDKN1A, central nodes of a dense network, allowing the cells to proliferate, even in the presence of tamoxifen.

References

• Ref 1: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 2: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 3: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.