Molecule Information

General Information of the Molecule (ID: Mol05809)

Name	hsa-miR-337 ,Homo sapiens
Molecule Type	Precursor miRNA
Sequence	GUAGUCAGUAGUUGGGGGGUGGGAACGGCUUCAUACAGGAGUUGAUGCACAGUUAUCCAG CUCCUAUAUGAUGCCUUUCUUCAUCCCCUUCAA Click to Show/Hide
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Docetaxel

Click to Show/Hide

Drug Sensitive Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0]				[1]
Sensitive Disease	Non-small cell lung cancer [ICD-11: 2C25.0]			Disease Info
Sensitive Drug	Docetaxel			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	NCI-H1155 cells	Lung	Homo sapiens (Human)	CVCL_1456
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	Flow cytometry analysis
Mechanism Description	Using in vitro approaches, we demonstrated that over-expression of the microRNA miR-337-3p sensitizes NCI-H1155 cells to paclitaxel, and that miR-337-3p mimic has a general effect on paclitaxel response in NSCLC cell lines, which may provide a novel adjuvant strategy to paclitaxel in the treatment of lung cancer. By combining in vitro and in silico approaches, we identified STAT3 and RAP1A as direct targets that mediate the effect of miR-337-3p on paclitaxel sensitivity. Further investigation showed that miR-337-3p mimic also sensitizes cells to docetaxel, another member of the taxane family, and that STAT3 levels are significantly correlated with taxane resistance in lung cancer cell lines, suggesting that endogenous STAT3 expression is a determinant of intrinsic taxane resistance in lung cancer.

Paclitaxel

Click to Show/Hide

Drug Sensitive Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0]				[1]
Sensitive Disease	Non-small cell lung cancer [ICD-11: 2C25.0]			Disease Info
Sensitive Drug	Paclitaxel			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	NCI-H1155 cells	Lung	Homo sapiens (Human)	CVCL_1456
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	Flow cytometry analysis
Mechanism Description	Using in vitro approaches, we demonstrated that over-expression of the microRNA miR-337-3p sensitizes NCI-H1155 cells to paclitaxel, and that miR-337-3p mimic has a general effect on paclitaxel response in NSCLC cell lines, which may provide a novel adjuvant strategy to paclitaxel in the treatment of lung cancer. By combining in vitro and in silico approaches, we identified STAT3 and RAP1A as direct targets that mediate the effect of miR-337-3p on paclitaxel sensitivity. Further investigation showed that miR-337-3p mimic also sensitizes cells to docetaxel, another member of the taxane family, and that STAT3 levels are significantly correlated with taxane resistance in lung cancer cell lines, suggesting that endogenous STAT3 expression is a determinant of intrinsic taxane resistance in lung cancer.

References

Ref 1	Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.