Molecule Information

General Information of the Molecule (ID: Mol05800)

• Name: hsa-miR-885 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  CCGCACUCUCUCCAUUACACUACCCUGCCUCUUCUCCAUGAGAGGCAGCGGGGUGUAGUG
  GAUAGAGCACGGGU

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Cell Pathway Regulation: ATO/miR-885-5p/MTPN axis; Regulation; N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: We found that ATO can reduce the resistance of CCA cells to 5-Fu and CDDP and promote the killing effect of 5-Fu and CDDP. Low-dose ATO showed an anti-drug-resistance effect through up-regulation of the expression of miR-885-5p. Combined with sequencing results and database predictions, we found that MTPN may serve as a direct target of miR-885-5p. After MTPN knockdown, the sensitivity of CCA cells to 5-FU and CDDP was increased. Finally, we found that ATO can reverse chemotherapy resistance induced by overexpression of MTPN.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: qRT-PCR, Reverse Transcription and Running ABC Transporter TLDA
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Using miRNA microfluidic arrays from ABI, we determined the microRNA profile for MCF7VP cells compared to drug sensitive cells. Multiple miRNAs showed differential expression among the cell lines including hsa-miR-382, hsa-miR-23b and hsa-miR-885-5p, which were up-regulated (>2-fold increase) in MCF7VP cells and hsa-mir-218, hsa-miR-758 and hsa-miR-548d-5p, which were down-regulated (>2-fold decrease) in MCF7VP cells, suggesting that etoposide resistant MCF7 cells have a miRNA profile that is distinct from the MCF7 drug sensitive cell line.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [3]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Wnt/beta-catenin signaling; Regulation; N.A.
• In Vitro Model: NCI-H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: NCI-H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: Sk-MES-1 cells; Lung; Homo sapiens (Human); CVCL_0630
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: The most intriguing is the activation of Wnt/-catenin signaling in gemcitabine resistant NSCLC cell lines. The miR-155, miR-10a, miR-30a, miR-24-2* and miR-30c-2* were upregulated in sensitive cell lines, while expression of miR-200c, miR-203, miR-885-5p, miR-195 and miR-25* was increased in resistant cell line.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Gastric cancer patients; Homo sapiens
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: qRT-PCR analysis was used to validate the results from the RNA sequencing. The expression levels of the DE miRNAs were analyzed following the chemotherapy cycles. The expression levels of miR-378f, miR-200c-3p, and miR-885-5p were higher in the group receiving chemotherapy for fewer than 4 cycles than in the group receiving chemotherapy for 4-7 cycles. The expression of miR-4666a-3p was not detectable in the qRT-PCR measurement. The expression of miR-378f was significantly downregulated (p = 0.0041) (Figure 2).

References

• Ref 1: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 2: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 3: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.