General Information of the Molecule (ID: Mol05780)
Name
hsa-miR-187-5p ,Homo sapiens
Molecule Type
Mature miRNA
Sequence
GGCUACAACACAGGACCCGGGC
    Click to Show/Hide
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [1]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model BT-20 cells Mammary gland Homo sapiens (Human) CVCL_0178
BT-474 cells Breast Homo sapiens (Human) CVCL_0179
BT-549 cells Breast Homo sapiens (Human) CVCL_1092
CAMA-1 cells Breast Homo sapiens (Human) CVCL_1115
HCC1143 cells Breast Homo sapiens (Human) CVCL_1245
HCC1806 cells Breast Homo sapiens (Human) CVCL_1258
HCC1937 cells Breast Homo sapiens (Human) CVCL_0290
HCC1954 cells Breast Homo sapiens (Human) CVCL_1259
HCC38 cells Breast Homo sapiens (Human) CVCL_1267
HCC70 cells Breast Homo sapiens (Human) CVCL_1270
Hs578T cells Breast Homo sapiens (Human) CVCL_0332
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
MDA-MB-361 cells Breast Homo sapiens (Human) CVCL_0620
MDA-MB-436 cells Breast Homo sapiens (Human) CVCL_0623
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
SK-BR-3 cells Pleural effusion Homo sapiens (Human) CVCL_0033
T47D cells Breast Homo sapiens (Human) CVCL_0553
EVSA-T cells Ascites Homo sapiens (Human) CVCL_1207
Sk-BR-7 cells Breast Homo sapiens (Human) CVCL_5218
SUM159PT cells Breast Homo sapiens (Human) CVCL_5423/CVCL_5590
SUM44PE cells Breast Homo sapiens (Human) CVCL_3424
SUM52PE cells Breast Homo sapiens (Human) CVCL_3425
Experiment for
Molecule Alteration
Microarray analyses
Mechanism Description The taxanes, Paclitaxel and Docetaxel, were the only drugs having miRNAs in common: hsa-miR-187-5p and hsa-miR-106a-3p indicative of drug resistance while Paclitaxel sensitivity alone associated with hsa-miR-556-5p
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [1]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model BT-20 cells Mammary gland Homo sapiens (Human) CVCL_0178
BT-474 cells Breast Homo sapiens (Human) CVCL_0179
BT-549 cells Breast Homo sapiens (Human) CVCL_1092
CAMA-1 cells Breast Homo sapiens (Human) CVCL_1115
HCC1143 cells Breast Homo sapiens (Human) CVCL_1245
HCC1806 cells Breast Homo sapiens (Human) CVCL_1258
HCC1937 cells Breast Homo sapiens (Human) CVCL_0290
HCC1954 cells Breast Homo sapiens (Human) CVCL_1259
HCC38 cells Breast Homo sapiens (Human) CVCL_1267
HCC70 cells Breast Homo sapiens (Human) CVCL_1270
Hs578T cells Breast Homo sapiens (Human) CVCL_0332
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
MDA-MB-361 cells Breast Homo sapiens (Human) CVCL_0620
MDA-MB-436 cells Breast Homo sapiens (Human) CVCL_0623
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
SK-BR-3 cells Pleural effusion Homo sapiens (Human) CVCL_0033
T47D cells Breast Homo sapiens (Human) CVCL_0553
EVSA-T cells Ascites Homo sapiens (Human) CVCL_1207
Sk-BR-7 cells Breast Homo sapiens (Human) CVCL_5218
SUM159PT cells Breast Homo sapiens (Human) CVCL_5423/CVCL_5590
SUM44PE cells Breast Homo sapiens (Human) CVCL_3424
SUM52PE cells Breast Homo sapiens (Human) CVCL_3425
Experiment for
Molecule Alteration
Microarray analyses
Mechanism Description This gene is up-regulated in paclitaxel-resistance cells
References
Ref 1 Alterations in p53 predict response to preoperative high dose chemotherapy in patients with gastric cancerMol Pathol. 2003 Oct;56(5):286-92. doi: 10.1136/mp.56.5.286.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.