General Information of the Molecule (ID: Mol05755)
Name
hsa-miR-518c ,Homo sapiens
Molecule Type
Precursor miRNA
Sequence
GCGAGAAGAUCUCAUGCUGUGACUCUCUGGAGGGAAGCACUUUCUGUUGUCUGAAAGAAA
ACAAAGCGCUUCUCUUUAGAGUGUUACGGUUUGAGAAAAGC
    Click to Show/Hide
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Testicular cancer [.] [1]
Resistant Disease Testicular cancer [.]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration
RT-qPCR with "Low Density Array"
Experiment for
Drug Resistance
MTT assay
Mechanism Description Examining almost all known human micro-RNA species confirmed the miR-371-373 cluster as a promising target for explaining cisplatin resistance, potentially by counteracting wild-type P53 induced senescence or linking it with the potency to differentiate. Moreover, we describe for the first time an association of the up-regulation of micro-RNA species such as hsa-miR-512-3p/-515/-517/-518/-525 and down-regulation of hsa-miR-99a/-100/-145 with a cisplatin resistant phenotype in human germ cell tumors.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model TOV21G cells Ovary Homo sapiens (Human) CVCL_3613
TOV112D cells Ovary Homo sapiens (Human) CVCL_3612
C13 cells Ovary Homo sapiens (Human) CVCL_0114
OV2008 cells Ovary Homo sapiens (Human) CVCL_0473
A2780CP cells Ovary Homo sapiens (Human) CVCL_0135
A2780s cells Ovary Homo sapiens (Human) CVCL_4863
IGROV1 cells Ovary Homo sapiens (Human) CVCL_1304
OVCAR5 cells Ovary Homo sapiens (Human) CVCL_1628
OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
Experiment for
Molecule Alteration
miRNA probe assay
Experiment for
Drug Resistance
Cell proliferation assays
Mechanism Description MicroRNAs (miRNAs) are 19 to 25-nucleotide, non-coding, RNA transcripts, thought to be instrumental in controlling eukaryotic cell function via modulation of post-transcriptional activity of multiple target mRNA genes by repression of translation or regulation of mRNA degradation.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [3]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K-AKT signalling pathway Regulation N.A.
Cell cycle pathways Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Cell viability assay; Cell cycle assays; Apoptosis assay
Mechanism Description Our findings indicate that tamoxifen-resistant cells express miRNA-519a at high levels, which directly represses the expression of PTEN, RB1, and CDKN1A, central nodes of a dense network, allowing the cells to proliferate, even in the presence of tamoxifen.
References
Ref 1 Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells. J Exp Clin Cancer Res. 2011 May 13;30(1):55. doi: 10.1186/1756-9966-30-55.
Ref 2 Sequential development of mutant clones in an imatinib resistant chronic myeloid leukaemia patient following sequential treatment with multiple tyrosine kinase inhibitors: an emerging problem . Cancer Chemother Pharmacol. 2009 Jun;64(1):195-7. doi: 10.1007/s00280-008-0905-5. Epub 2009 Jan 21.
Ref 3 Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.