Molecule Information

General Information of the Molecule (ID: Mol05749)

• Name: hsa-miR-637 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence: ACUGGGGGCUUUCGGGCUCUGCGU

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: miR-637/CDX2; Regulation; N.A.
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Western blot; Dual-luciferase reporter assay; RIP assay; Immunohistochemistry assay
• Experiment for Drug Resistance: CCK8 assay; Cell cycle and apoptosis analysis
• Mechanism Description: Circ_0017274 and CDX2 had higher content in CDDP-resistant GC tissues and cells, while miR-637 had lower content

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability Assay (Promega)
• Mechanism Description: Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Clinical Trial Drug(s) 1 drug(s) in total

Tivantinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tivantinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BT-20 cells; Mammary gland; Homo sapiens (Human); CVCL_0178
• In Vitro Model: BT-474 cells; Breast; Homo sapiens (Human); CVCL_0179
• In Vitro Model: BT-549 cells; Breast; Homo sapiens (Human); CVCL_1092
• In Vitro Model: CAMA-1 cells; Breast; Homo sapiens (Human); CVCL_1115
• In Vitro Model: HCC1143 cells; Breast; Homo sapiens (Human); CVCL_1245
• In Vitro Model: HCC1806 cells; Breast; Homo sapiens (Human); CVCL_1258
• In Vitro Model: HCC1937 cells; Breast; Homo sapiens (Human); CVCL_0290
• In Vitro Model: HCC1954 cells; Breast; Homo sapiens (Human); CVCL_1259
• In Vitro Model: HCC38 cells; Breast; Homo sapiens (Human); CVCL_1267
• In Vitro Model: HCC70 cells; Breast; Homo sapiens (Human); CVCL_1270
• In Vitro Model: Hs578T cells; Breast; Homo sapiens (Human); CVCL_0332
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-361 cells; Breast; Homo sapiens (Human); CVCL_0620
• In Vitro Model: MDA-MB-436 cells; Breast; Homo sapiens (Human); CVCL_0623
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vitro Model: SK-BR-3 cells; Pleural effusion; Homo sapiens (Human); CVCL_0033
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: EVSA-T cells; Ascites; Homo sapiens (Human); CVCL_1207
• In Vitro Model: Sk-BR-7 cells; Breast; Homo sapiens (Human); CVCL_5218
• In Vitro Model: SUM159PT cells; Breast; Homo sapiens (Human); CVCL_5423/CVCL_5590
• In Vitro Model: SUM44PE cells; Breast; Homo sapiens (Human); CVCL_3424
• In Vitro Model: SUM52PE cells; Breast; Homo sapiens (Human); CVCL_3425
• Experiment for Molecule Alteration: Microarray analyses
• Mechanism Description: This gene is up-regulated in tipifarnib-resistance cells

References

• Ref 1: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 2: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
• Ref 3: Alterations in p53 predict response to preoperative high dose chemotherapy in patients with gastric cancerMol Pathol. 2003 Oct;56(5):286-92. doi: 10.1136/mp.56.5.286.