Molecule Information

General Information of the Molecule (ID: Mol05744)

• Name: hsa-miR-889 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  GUGCUUAAAGAAUGGCUGUCCGUAGUAUGGUCUCUAUAUUUAUGAUGAUUAAUAUCGGAC
  AACCAUUGUUUUAGUAUCC

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [1]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; FACS analysis
• Mechanism Description: Using the microRNA.org and TargetScan databases, approximately 14 of the down-regulated miRs are predicted to target the 3'-UTR of the MDR1 gene. Expression of hsa-mir-889 decreases.

References

• Ref 1: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.