Molecule Information

General Information of the Molecule (ID: Mol05738)

• Name: hsa-miR-1293 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence: UGGGUGGUCUGGAGAUUUGUGC

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAPK signalling pathway; Regulation; N.A.
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• Experiment for Molecule Alteration: Small RNA library construction and sequencing; qRT-PCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Function annotation implied that these selected miRNAs affected many target genes mainly involved in MAPK signaling pathway.

Clinical Trial Drug(s) 1 drug(s) in total

PLX4720

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] [2]

• Resistant Disease: Papillary thyroid carcinoma [ICD-11: 2D10.1]
• Resistant Drug: PLX4720
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: Immunoblot analysis; qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: This gene is up-regulated in PLX4720-resistance cells

References

• Ref 1: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 2: Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.