Molecule Information

General Information of the Molecule (ID: Mol05731)

Name	hsa-miR-1277 ,Homo sapiens
Molecule Type	Precursor miRNA
Sequence	ACCUCCCAAAUAUAUAUAUAUAUGUACGUAUGUGUAUAUAAAUGUAUACGUAGAUAUAUA UGUAUUUUUGGUGGGUUU Click to Show/Hide
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0]				[1]
Resistant Disease	Hepatocellular carcinoma [ICD-11: 2C12.0]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	MAPK signalling pathway		Regulation	N.A.
In Vitro Model	HepG2 cells	Liver	Homo sapiens (Human)	CVCL_0027
Experiment for Molecule Alteration	Small RNA library construction and sequencing; qRT-PCR
Experiment for Drug Resistance	Cell viability assay
Mechanism Description	Function annotation implied that these selected miRNAs affected many target genes mainly involved in MAPK signaling pathway.

Paclitaxel

Click to Show/Hide

Drug Sensitive Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)		Click to Show/Hide
Disease Class: Laryngeal carcinoma [ICD-11: 2C23.0]			[1]
Sensitive Disease	Laryngeal carcinoma [ICD-11: 2C23.0]		Disease Info
Sensitive Drug	Paclitaxel		Drug Info
Molecule Alteration	Expression	Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Experiment for Molecule Alteration	Microarray analysis; qRT-PCR
Experiment for Drug Resistance	Cell viability assay
Mechanism Description	The possible mechanism by which ER-associated genes mediate paclitaxel sensitivity is in that ER is associated with the microtubule cytoskeleton, exactly site where paclitaxel exerts its cytotoxic effect in cancer cells.

References

Ref 1	VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.