General Information of the Molecule (ID: Mol05695)
Name
hsa-miR-668 ,Homo sapiens
Molecule Type
Precursor miRNA
Sequence
GGUAAGUGCGCCUCGGGUGAGCAUGCACUUAAUGUGGGUGUAUGUCACUCGGCUCGGCCC
ACUACC
    Click to Show/Hide
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
Resistant Drug Sorafenib
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration
RT-PCR; Western blot; Luciferase assay
Experiment for
Drug Resistance
Cytotoxicity assay; Apoptosis assays
Mechanism Description Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [2]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.0]
Resistant Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
A549 cells Lung Homo sapiens (Human) CVCL_0023
A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot
Experiment for
Drug Resistance
MTT assay; Apoptosis assay
Disease Class: Gastric cancer [ICD-11: 2B72.0] [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.0]
Resistant Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
A549 cells Lung Homo sapiens (Human) CVCL_0023
A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot
Experiment for
Drug Resistance
MTT assay; Apoptosis assay
References
Ref 1 Downregulation of miR-21 enhances chemotherapeutic effect of taxol in breast carcinoma cells. Technol Cancer Res Treat. 2010 Feb;9(1):77-86. doi: 10.1177/153303461000900109.
Ref 2 miR-181b modulates multidrug resistance by targeting BCL2 in human cancer cell lines. Int J Cancer. 2010 Dec 1;127(11):2520-9. doi: 10.1002/ijc.25260.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.