Molecule Information

General Information of the Molecule (ID: Mol05693)

• Name: hsa-miR-182-3p ,Homo sapiens
• Molecule Type: Mature miRNA
• Sequence: UGGUUCUAGACUUGCCAACUA

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot
• Experiment for Drug Resistance: MTT assay; Apoptosis assay

Disease Class: Gastric cancer [ICD-11: 2B72.0] [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot
• Experiment for Drug Resistance: MTT assay; Apoptosis assay

References

• Ref 1: miR-181b modulates multidrug resistance by targeting BCL2 in human cancer cell lines. Int J Cancer. 2010 Dec 1;127(11):2520-9. doi: 10.1002/ijc.25260.