Molecule Information

General Information of the Molecule (ID: Mol05308)

• Name: hsa-miR-188-5p ,Homo sapiens
• Molecule Type: Mature miRNA
• Sequence: CAUCCCUUGCAUGGUGGAGGG

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [1]

• Resistant Disease: Neuroblastoma [ICD-11: 2A00.02]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: FBXW7/c-Myc signalling pathway; Regulation; N.A.
• In Vitro Model: SH-SY5Y cells; Abdomen; Homo sapiens (Human); CVCL_0019
• In Vitro Model: Kelly cells; Adrenal; Homo sapiens (Human); CVCL_2092
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Luminescence-based cell viability analysis
• Mechanism Description: However, it certainly is of interest to highlight the possible involvement of such miRNAs in affecting the most common means of chemoresistance-inducing cellular pathways within such cell lines. A typical example would be the effect of such miRNAs on the ABC transporter system and its member genes that regulate drug efflux properties of the cell.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [1]

• Resistant Disease: Neuroblastoma [ICD-11: 2A00.02]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SH-SY5Y cells; Abdomen; Homo sapiens (Human); CVCL_0019
• In Vitro Model: Kelly cells; Adrenal; Homo sapiens (Human); CVCL_2092
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Luminescence-based cell viability analysis
• Mechanism Description: However, it certainly is of interest to highlight the possible involvement of such miRNAs in affecting the most common means of chemoresistance-inducing cellular pathways within such cell lines. A typical example would be the effect of such miRNAs on the ABC transporter system and its member genes that regulate drug efflux properties of the cell.

References

• Ref 1: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 2: The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.