Molecule Information

General Information of the Molecule (ID: Mol05297)

Name	hsa-miR-203a-3p ,Homo sapiens
Molecule Type	Mature miRNA
Sequence	GUGAAAUGUUUAGGACCACUAG Click to Show/Hide
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

4 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0]				[1]
Resistant Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	The most upregulated circRNA, miRNA, and mRNA were hsa_circ_0004674 (17-fold change), hsa-miR-337-3p (12-fold change), and C6orf106 (124-fold change), respectively. The most downregulated circRNA, miRNA, and mRNA were hsa_circ_0068458 (12-fold change), hsa-miR-203a-3p (10-fold change), and AKR1C2 (197-fold change), respectively.

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0]				[1]
Resistant Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	The most upregulated circRNA, miRNA, and mRNA were hsa_circ_0004674 (17-fold change), hsa-miR-337-3p (12-fold change), and C6orf106 (124-fold change), respectively. The most downregulated circRNA, miRNA, and mRNA were hsa_circ_0068458 (12-fold change), hsa-miR-203a-3p (10-fold change), and AKR1C2 (197-fold change), respectively.

Ifosfamide

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0]				[1]
Resistant Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Resistant Drug	Ifosfamide			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	The most upregulated circRNA, miRNA, and mRNA were hsa_circ_0004674 (17-fold change), hsa-miR-337-3p (12-fold change), and C6orf106 (124-fold change), respectively. The most downregulated circRNA, miRNA, and mRNA were hsa_circ_0068458 (12-fold change), hsa-miR-203a-3p (10-fold change), and AKR1C2 (197-fold change), respectively.

Methotrexate

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0]				[1]
Resistant Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Resistant Drug	Methotrexate			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	The most upregulated circRNA, miRNA, and mRNA were hsa_circ_0004674 (17-fold change), hsa-miR-337-3p (12-fold change), and C6orf106 (124-fold change), respectively. The most downregulated circRNA, miRNA, and mRNA were hsa_circ_0068458 (12-fold change), hsa-miR-203a-3p (10-fold change), and AKR1C2 (197-fold change), respectively.

References

Ref 1	Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.