Molecule Information

General Information of the Molecule (ID: Mol05226)

Name	hsa-miR-29b-2 ,Homo sapiens
Molecule Type	Precursor miRNA
Sequence	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAU UUGAAAUCAGUGUUUUAGGAG Click to Show/Hide
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Fluorouracil

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)		Click to Show/Hide
Disease Class: Rectal cancer [ICD-11: 2B92.0]			[2]
Resistant Disease	Rectal cancer [ICD-11: 2B92.0]		Disease Info
Resistant Drug	Fluorouracil		Drug Info
Molecule Alteration	Expression	Up-regulation
Experimental Note	Identified from the Human Clinical Data
Experiment for Molecule Alteration	Gene expression profiling assay
Mechanism Description	MiR-215, miR-190b and miR-29b-2* have been overexpressed in non-responders, and let-7e, miR-196b, miR-450a, miR-450b-5p and miR-99a* have shown higher expression levels in responders

Capecitabine

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)		Click to Show/Hide
Disease Class: Rectal cancer [ICD-11: 2B92.0]			[2]
Resistant Disease	Rectal cancer [ICD-11: 2B92.0]		Disease Info
Resistant Drug	Capecitabine		Drug Info
Molecule Alteration	Expression	Up-regulation
Experimental Note	Identified from the Human Clinical Data
Experiment for Molecule Alteration	Gene expression profiling assay
Mechanism Description	MiR-215, miR-190b and miR-29b-2* have been overexpressed in non-responders, and let-7e, miR-196b, miR-450a, miR-450b-5p and miR-99a* have shown higher expression levels in responders

References

Ref 1	Metallo-Beta-lactamase expression confers an advantage to Pseudomonas aeruginosa isolates compared with other Beta-lactam resistance mechanisms, favoring the prevalence of metallo-Beta-lactamase producers in a clinical environment. Microb Drug Resist. 2010 Sep;16(3):223-30. doi: 10.1089/mdr.2010.0016.
Ref 2	Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
Ref 3	Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.