Molecule Information

General Information of the Molecule (ID: Mol05225)

• Name: hsa-miR-147a ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence: GUGUGUGGAAAUGCUUCUGC

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gefitinib

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: EMT; Regulation; N.A.
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR, microarray assay
• Experiment for Drug Resistance: Flow cytometry analysis
• Mechanism Description: MiR-147 recovered cell sensitivity to EGFRi gefitinb.

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: EMT; Regulation; N.A.
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR, microarray assay
• Experiment for Drug Resistance: Flow cytometry analysis
• Mechanism Description: MiR-147 recovered cell sensitivity to EGFRi gefitinb.

References

• Ref 1: Novel ATP-competitive MEK inhibitor E6201 is effective against vemurafenib-resistant melanoma harboring the MEK1-C121S mutation in a preclinical modelMol Cancer Ther. 2014 Apr;13(4):823-32. doi: 10.1158/1535-7163.MCT-13-0667. Epub 2014 Jan 21.