General Information of the Molecule (ID: Mol05122)
Name
hsa-miR-331-3p ,Homo sapiens
Molecule Type
Mature miRNA
Sequence
GCCCCUGGGCCUAUCCUAGAA
    Click to Show/Hide
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.0] [1]
Resistant Disease Esophageal squamous cell carcinoma [ICD-11: 2B70.0]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model OE19 cells Esophagus Homo sapiens (Human) CVCL_1622
kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
Experiment for
Molecule Alteration
qPCR
Mechanism Description Chemotherapy resistant sublines were found to have specific miRNA signatures, and these miRNA signatures were different for the cisplatin vs 5-FU resistant cells from the same tumor cell line, and also for EAC vs ESCC cells with resistance to the same specific chemotherapy agent. Amongst others, miR-27b-3p, miR-193b-3p, miR-192-5p, miR-378 a-3p, miR-125a-5p and miR-18a-3p were dysregulated, consistent with negative posttranscriptional control of KRAS, TYMS, ABCC3, CBL-B and ERBB2 expression via these miRNAs.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
PLX4720
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] [2]
Resistant Disease Papillary thyroid carcinoma [ICD-11: 2D10.1]
Resistant Drug PLX4720
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration
Immunoblot analysis; qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description This gene is up-regulated in PLX4720-resistance cells
References
Ref 1 The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
Ref 2 Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.