Molecule Information

General Information of the Molecule (ID: Mol05116)

• Name: hsa-miR-25-3p ,Homo sapiens
• Molecule Type: Mature miRNA
• Sequence: CAUUGCACUUGUCUCGGUCUGA

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [ICD-11: 2B51.0] [1]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Wnt/beta-catenin pathway; Regulation; N.A.
• In Vitro Model: 143B cells; Bone; Homo sapiens (Human); CVCL_2270
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vivo Model: Osteosarcoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-PCR; Western blot; Luciferase assay; Immunohistochemistry
• Experiment for Drug Resistance: Cell proliferation assays; Cytotoxicity assays; Cell migration assay; Cell invasion assay
• Mechanism Description: Intracellular miR-25-3p contributed to cellular proliferation, invasion, and drug resistance, which are lethal OS phenotypes.By contrast, the expression of the Wnt signaling inhibitor DKK3, a miR-25-3p target, was correlated with a good prognosis in the OS patients.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [2]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: Microarray analyses; Luciferase reporter assay; Western blot
• Experiment for Drug Resistance: Cell proliferation assays; MTT assay

References

• Ref 1: Clinical and Functional Significance of Intracellular and Extracellular microRNA-25-3p in Osteosarcoma. Acta Med Okayama. 2018 Apr;72(2):165-174
• Ref 2: Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.