Molecule Information

General Information of the Molecule (ID: Mol05058)

Name	hsa-miR-517c ,Homo sapiens
Molecule Type	Precursor miRNA
Sequence	GAAGAUCUCAGGCAGUGACCCUCUAGAUGGAAGCACUGUCUGUUGUCUAAGAAAAGAUCG UGCAUCCUUUUAGAGUGUUACUGUUUGAGAAAAUC Click to Show/Hide
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

4 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)		Click to Show/Hide
Disease Class: Testicular cancer [.]			[1]
Resistant Disease	Testicular cancer [.]		Disease Info
Resistant Drug	Cisplatin		Drug Info
Molecule Alteration	Expression	Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Experiment for Molecule Alteration	RT-qPCR with "Low Density Array"
Experiment for Drug Resistance	MTT assay
Mechanism Description	Examining almost all known human micro-RNA species confirmed the miR-371-373 cluster as a promising target for explaining cisplatin resistance, potentially by counteracting wild-type P53 induced senescence or linking it with the potency to differentiate. Moreover, we describe for the first time an association of the up-regulation of micro-RNA species such as hsa-miR-512-3p/-515/-517/-518/-525 and down-regulation of hsa-miR-99a/-100/-145 with a cisplatin resistant phenotype in human germ cell tumors.

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2]				[2]
Resistant Disease	Breast cancer [ICD-11: 2C60.2]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
Experiment for Molecule Alteration	MiRNA microarray; RT-PCR; Western blot
Experiment for Drug Resistance	MTT assay
Mechanism Description	MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Tamoxifen

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2]				[3]
Resistant Disease	Breast cancer [ICD-11: 2C60.2]			Disease Info
Resistant Drug	Tamoxifen			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	PI3K-AKT signalling pathway		Regulation	N.A.
	Cell cycle pathways		Regulation	N.A.
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	Cell viability assay; Cell cycle assays; Apoptosis assay
Mechanism Description	Our findings indicate that tamoxifen-resistant cells express miRNA-519a at high levels, which directly represses the expression of PTEN, RB1, and CDKN1A, central nodes of a dense network, allowing the cells to proliferate, even in the presence of tamoxifen.

Verapamil

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2]				[2]
Resistant Disease	Breast cancer [ICD-11: 2C60.2]			Disease Info
Resistant Drug	Verapamil			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
Experiment for Molecule Alteration	MiRNA microarray; RT-PCR; Western blot
Experiment for Drug Resistance	MTT assay
Mechanism Description	MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

References

Ref 1	Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells. J Exp Clin Cancer Res. 2011 May 13;30(1):55. doi: 10.1186/1756-9966-30-55.
Ref 2	The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
Ref 3	Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.