Molecule Information

General Information of the Molecule (ID: Mol05013)
Name
hsa-miR-19b-2 ,Homo sapiens
Molecule Type
Precursor miRNA
Sequence
ACAUUGCUACUUACAAUUAGUUUUGCAGGUUUGCAUUUCAGCGUAUAUAUGUAUAUGUGG
CUGUGCAAAUCCAUGCAAAACUGAUUGUGAUAAUGU
    Click to Show/Hide
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [1]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vivo Model Colon cancer patients Homo sapiens
Experiment for
Molecule Alteration		 Differential expression analysis; GO Analysis
Mechanism Description These eight miRNAs (has-mir-141, -19a, -20a 19b-1, 19b-2, 16, 590 and -335) and two genes (MSX1 and KRT7) may play a role in the process of COAD.
References
Ref 1 APC Mutations as a Potential Biomarker for Sensitivity to Tankyrase Inhibitors in Colorectal CancerMol Cancer Ther. 2017 Apr;16(4):752-762. doi: 10.1158/1535-7163.MCT-16-0578. Epub 2017 Feb 8.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.