General Information of the Molecule (ID: Mol04187)
Name
microRNA-4763-3p (miR-4763-3p) ,Homo sapiens
Synonyms
microRNA 4763
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AGGCAGGGGCUGGUGCUGGGCGGG
    Click to Show/Hide
Ensembl ID
ENSG00000284175
HGNC ID
HGNC:41677
Mature Accession
MIMAT0019913
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  MRAP: Metabolic Reprogramming via Altered Pathways
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Metabolic Reprogramming via Altered Pathways (MRAP) Click to Show/Hide
Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [1]
Metabolic Type Nucleic acid metabolism
Sensitive Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model AsPC1 cells Pancreas Homo sapiens (Human) CVCL_0152
Experiment for
Molecule Alteration
qRT-PCR; Western blot analysis
Experiment for
Drug Resistance
Cell viability assay
Mechanism Description Here, we show that prolactin receptor (PRLR) synergizes with gemcitabine in both in vitro and in vivo treatment of PDAC. Interestingly, PRLR promotes the expression of miR-4763-3p and miR-3663-5p, two novel miRNAs whose functions are unknown. Furthermore, the analysis of transcriptome sequencing data of tumors from lactating mouse models enriches the PPP pathway, a multifunctional metabolic pathway. In addition to providing energy, the PPP pathway mainly provides a variety of raw materials for anabolism.
Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [1]
Metabolic Type Nucleic acid metabolism
Sensitive Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model CFPAC-1 cells Pancreas Homo sapiens (Human) CVCL_1119
Experiment for
Molecule Alteration
qRT-PCR; Western blot analysis
Experiment for
Drug Resistance
Cell viability assay
Mechanism Description Here, we show that prolactin receptor (PRLR) synergizes with gemcitabine in both in vitro and in vivo treatment of PDAC. Interestingly, PRLR promotes the expression of miR-4763-3p and miR-3663-6p, two novel miRNAs whose functions are unknown. Furthermore, the analysis of transcriptome sequencing data of tumors from lactating mouse models enriches the PPP pathway, a multifunctional metabolic pathway. In addition to providing energy, the PPP pathway mainly provides a variety of raw materials for anabolism.
Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [1]
Metabolic Type Nucleic acid metabolism
Sensitive Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model BxPc3 cells Pancreas Homo sapiens (Human) CVCL_0186
Experiment for
Molecule Alteration
qRT-PCR; Western blot analysis
Experiment for
Drug Resistance
Cell viability assay
Mechanism Description Here, we show that prolactin receptor (PRLR) synergizes with gemcitabine in both in vitro and in vivo treatment of PDAC. Interestingly, PRLR promotes the expression of miR-4763-3p and miR-3663-7p, two novel miRNAs whose functions are unknown. Furthermore, the analysis of transcriptome sequencing data of tumors from lactating mouse models enriches the PPP pathway, a multifunctional metabolic pathway. In addition to providing energy, the PPP pathway mainly provides a variety of raw materials for anabolism.
Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [1]
Metabolic Type Nucleic acid metabolism
Sensitive Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vivo Model 6-to 8-week-old athymic female nu/nu mice, with fresh tissue from patient Mice
Experiment for
Molecule Alteration
qRT-PCR; Western blot analysis
Experiment for
Drug Resistance
Tumor weight assay
Mechanism Description Here, we show that prolactin receptor (PRLR) synergizes with gemcitabine in both in vitro and in vivo treatment of PDAC. Interestingly, PRLR promotes the expression of miR-4763-3p and miR-3663-8p, two novel miRNAs whose functions are unknown. Furthermore, the analysis of transcriptome sequencing data of tumors from lactating mouse models enriches the PPP pathway, a multifunctional metabolic pathway. In addition to providing energy, the PPP pathway mainly provides a variety of raw materials for anabolism.
References
Ref 1 Prolactin receptor potentiates chemotherapy through miRNAs-induced G6PD/TKT inhibition in pancreatic cancer. FASEB J. 2024 May 31;38(10):e23705.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.