Molecule Information

General Information of the Molecule (ID: Mol04187)

• Name: microRNA-4763-3p (miR-4763-3p) ,Homo sapiens
• Synonyms: microRNA 4763
• Molecule Type: Mature miRNA
• Sequence: AGGCAGGGGCUGGUGCUGGGCGGG
• Ensembl ID: ENSG00000284175
• HGNC ID: HGNC:41677
• Mature Accession: MIMAT0019913

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  MRAP: Metabolic Reprogramming via Altered Pathways

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Metabolic Reprogramming via Altered Pathways (MRAP)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [1]

• Metabolic Type: Nucleic acid metabolism
• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: AsPC1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• Experiment for Molecule Alteration: qRT-PCR; Western blot analysis
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Here, we show that prolactin receptor (PRLR) synergizes with gemcitabine in both in vitro and in vivo treatment of PDAC. Interestingly, PRLR promotes the expression of miR-4763-3p and miR-3663-5p, two novel miRNAs whose functions are unknown. Furthermore, the analysis of transcriptome sequencing data of tumors from lactating mouse models enriches the PPP pathway, a multifunctional metabolic pathway. In addition to providing energy, the PPP pathway mainly provides a variety of raw materials for anabolism.

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [1]

• Metabolic Type: Nucleic acid metabolism
• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: CFPAC-1 cells; Pancreas; Homo sapiens (Human); CVCL_1119
• Experiment for Molecule Alteration: qRT-PCR; Western blot analysis
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Here, we show that prolactin receptor (PRLR) synergizes with gemcitabine in both in vitro and in vivo treatment of PDAC. Interestingly, PRLR promotes the expression of miR-4763-3p and miR-3663-6p, two novel miRNAs whose functions are unknown. Furthermore, the analysis of transcriptome sequencing data of tumors from lactating mouse models enriches the PPP pathway, a multifunctional metabolic pathway. In addition to providing energy, the PPP pathway mainly provides a variety of raw materials for anabolism.

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [1]

• Metabolic Type: Nucleic acid metabolism
• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BxPc3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• Experiment for Molecule Alteration: qRT-PCR; Western blot analysis
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Here, we show that prolactin receptor (PRLR) synergizes with gemcitabine in both in vitro and in vivo treatment of PDAC. Interestingly, PRLR promotes the expression of miR-4763-3p and miR-3663-7p, two novel miRNAs whose functions are unknown. Furthermore, the analysis of transcriptome sequencing data of tumors from lactating mouse models enriches the PPP pathway, a multifunctional metabolic pathway. In addition to providing energy, the PPP pathway mainly provides a variety of raw materials for anabolism.

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [1]

• Metabolic Type: Nucleic acid metabolism
• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vivo Model: 6-to 8-week-old athymic female nu/nu mice, with fresh tissue from patient; Mice
• Experiment for Molecule Alteration: qRT-PCR; Western blot analysis
• Experiment for Drug Resistance: Tumor weight assay
• Mechanism Description: Here, we show that prolactin receptor (PRLR) synergizes with gemcitabine in both in vitro and in vivo treatment of PDAC. Interestingly, PRLR promotes the expression of miR-4763-3p and miR-3663-8p, two novel miRNAs whose functions are unknown. Furthermore, the analysis of transcriptome sequencing data of tumors from lactating mouse models enriches the PPP pathway, a multifunctional metabolic pathway. In addition to providing energy, the PPP pathway mainly provides a variety of raw materials for anabolism.

References

• Ref 1: Prolactin receptor potentiates chemotherapy through miRNAs-induced G6PD/TKT inhibition in pancreatic cancer. FASEB J. 2024 May 31;38(10):e23705.