Molecule Information

General Information of the Molecule (ID: Mol04185)

• Name: microRNA-18a-5p (miR-18a-5p) ,Homo sapiens
• Synonyms: microRNA 18a
• Molecule Type: Mature miRNA
• Sequence: UAAGGUGCAUCUAGUGCAGAUAG
• Ensembl ID: ENSG00000283815
• HGNC ID: HGNC:31548
• Mature Accession: MIMAT0000072

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  MRAP: Metabolic Reprogramming via Altered Pathways

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Daunorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Metabolic Reprogramming via Altered Pathways (MRAP)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [1]

• Metabolic Type: Glucose metabolism
• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Daunorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: K562/ADM cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vitro Model: K563 cells; Blood; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: These results provided new evidence that miR-18a-5p may suppress the Warburg effect by targeting HIF-1alpha.Cells transfected with miR-18a-5p mimics were more sensitive to Adriamycin (AMD) compared with AMD group.

References

• Ref 1: MicroRNA-18a-5p regulates the Warburg effect by targeting hypoxia-inducible factor 1alpha in the K562/ADM cell line. Exp Ther Med. 2021 Oct;22(4):1069.