Molecule Information

General Information of the Molecule (ID: Mol04179)

• Name: microRNA-125b (miR-125b) ,Homo sapiens
• Synonyms: microRNA 125b
• Molecule Type: Mature miRNA
• Sequence: UCCCUGAGACCCUAACUUGUGA
• Ensembl ID: ENSG00000207971
• HGNC ID: HGNC:31506
• Mature Accession: MIMAT0000423

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  MRAP: Metabolic Reprogramming via Altered Pathways

Drug Resistance Data Categorized by Drug

Clinical Trial Drug(s) 1 drug(s) in total

Alisertib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Metabolic Reprogramming via Altered Pathways (MRAP)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]

• Metabolic Type: Glucose metabolism
• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Alisertib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCT8 cells; Colon; Homo sapiens (Human); CVCL_2478
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Cell colony formation assay
• Mechanism Description: Similarly, miR-125b mimic decreased the glycolysis [(25.28±9.51) mpH/min] in HCT-8-7T cells as compared with that [(54.38±12.70)mpH/min,P=0.003] in HCT-8-7T cells transfected with control. Meanwhile, in comparison with control transfected HCT-8-7T cells, miR-125b mimic also significantly led to an increase in the levels of p53 and beta-catenin, in parallel with a decrease in the levels of PFK1 and HK1 in HCT-8-7T cells

References

• Ref 1: [Targeting microRNA-125b inhibited the metastasis of Alisertib resistance cells through mediating p53 pathway]. Zhonghua Zhong Liu Za Zhi. 2023 Jun 23;45(6):499-507.