Molecule Information
General Information of the Molecule (ID: Mol01788)
Name |
piR-hsa-36712
,Homo sapiens
|
||||
---|---|---|---|---|---|
Molecule Type |
Piwi-interacting RNA
|
||||
Sequence |
AAAAAGAAAGAAATGAATGCTTGGGACCAGAAGT
Click to Show/Hide
|
||||
piRBase ID | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [1] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell migration | Activation | hsa04670 | ||
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
ZR75-1 cells | Breast | Homo sapiens (Human) | CVCL_0588 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | PIWI-interacting RNA-36712 restrains breast cancer progression and chemoresistance by interaction with SEPW1 pseudogene SEPW1P RNA. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [1] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell migration | Activation | hsa04670 | ||
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
ZR75-1 cells | Breast | Homo sapiens (Human) | CVCL_0588 | |
In Vivo Model | Mouse xenograft models | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | PIWI-interacting RNA-36712 restrains breast cancer progression and chemoresistance by interaction with SEPW1 pseudogene SEPW1P RNA. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.