Molecule Information
General Information of the Molecule (ID: Mol01787)
Name |
piR-hsa-39980
,Homo sapiens
|
||||
---|---|---|---|---|---|
Molecule Type |
Piwi-interacting RNA
|
||||
Sequence |
AAGAACATATGTGGCCACATTACC
Click to Show/Hide
|
||||
piRBase ID | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Neuroblastoma | [1] | |||
Resistant Disease | Neuroblastoma [ICD-11: 2A00.11] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell metastasis | Activation | hsa05205 | ||
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | IMR-32 cells | Abdomen | Homo sapiens (Human) | CVCL_0346 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | piR-39980 is an oncogenic piRNA overexpressed in NB cells which induces the cancer cell growth, enhance metastasis, and inhibit the cellular senescence by targeting JAk3 as well as desensitizes the chemotherapeutic drug. And piR-39980 was found to desensitize the effect of doxorubicin and inhibit drug-induced apoptosis. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.