General Information of the Molecule (ID: Mol01786)
Name
piR-hsa-54265 ,Homo sapiens
Molecule Type
Piwi-interacting RNA
Sequence
ATCTGCTGCGGATCGACAGGAACC
    Click to Show/Hide
piRBase ID
piR-hsa-54265
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal adenocarcinoma [ICD-11: 2B91.2] [1]
Resistant Disease Colorectal adenocarcinoma [ICD-11: 2B91.2]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell metastasis Activation hsa05205
Cell proliferation Activation hsa05200
STAT3 signaling pathway Activation hsa04550
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay; Colony formation assays
Mechanism Description piR-54265 binds PIWIL2 promotes CRC cell proliferation and invasiveness and 5-FU and oxaliplatin resistance via promoting oncogenic STAT3 signaling.
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal adenocarcinoma [ICD-11: 2B91.2] [1]
Resistant Disease Colorectal adenocarcinoma [ICD-11: 2B91.2]
Resistant Drug Oxaliplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell proliferation Activation hsa05200
STAT3 signaling pathway Activation hsa04550
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay; Colony formation assays
Mechanism Description piR-54265 binds PIWIL2 promotes CRC cell proliferation and invasiveness and 5-FU and oxaliplatin resistance via promoting oncogenic STAT3 signaling.
References
Ref 1 PIWI-interacting RNA-54265 is oncogenic and a potential therapeutic target in colorectal adenocarcinoma. Theranostics. 2018 Oct 6;8(19):5213-5230. doi: 10.7150/thno.28001. eCollection 2018.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.