Molecule Information
General Information of the Molecule (ID: Mol01786)
| Name |
piR-hsa-54265
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Molecule Type |
Piwi-interacting RNA
|
||||
| Sequence |
ATCTGCTGCGGATCGACAGGAACC
Click to Show/Hide
|
||||
| piRBase ID | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal adenocarcinoma [ICD-11: 2B91.2] | [1] | |||
| Resistant Disease | Colorectal adenocarcinoma [ICD-11: 2B91.2] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell metastasis | Activation | hsa05205 | ||
| Cell proliferation | Activation | hsa05200 | ||
| STAT3 signaling pathway | Activation | hsa04550 | ||
| In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Colony formation assays | |||
| Mechanism Description | piR-54265 binds PIWIL2 promotes CRC cell proliferation and invasiveness and 5-FU and oxaliplatin resistance via promoting oncogenic STAT3 signaling. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal adenocarcinoma [ICD-11: 2B91.2] | [1] | |||
| Resistant Disease | Colorectal adenocarcinoma [ICD-11: 2B91.2] | |||
| Resistant Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
| Cell proliferation | Activation | hsa05200 | ||
| STAT3 signaling pathway | Activation | hsa04550 | ||
| In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Colony formation assays | |||
| Mechanism Description | piR-54265 binds PIWIL2 promotes CRC cell proliferation and invasiveness and 5-FU and oxaliplatin resistance via promoting oncogenic STAT3 signaling. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
