Molecule Information
General Information of the Molecule (ID: Mol01786)
Name |
piR-hsa-54265
,Homo sapiens
|
||||
---|---|---|---|---|---|
Molecule Type |
Piwi-interacting RNA
|
||||
Sequence |
ATCTGCTGCGGATCGACAGGAACC
Click to Show/Hide
|
||||
piRBase ID | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal adenocarcinoma | [1] | |||
Resistant Disease | Colorectal adenocarcinoma [ICD-11: 2B91.2] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell metastasis | Activation | hsa05205 | ||
Cell proliferation | Activation | hsa05200 | ||
STAT3 signaling pathway | Activation | hsa04550 | ||
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Colony formation assays | |||
Mechanism Description | piR-54265 binds PIWIL2 promotes CRC cell proliferation and invasiveness and 5-FU and oxaliplatin resistance via promoting oncogenic STAT3 signaling. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal adenocarcinoma | [1] | |||
Resistant Disease | Colorectal adenocarcinoma [ICD-11: 2B91.2] | |||
Resistant Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
Cell proliferation | Activation | hsa05200 | ||
STAT3 signaling pathway | Activation | hsa04550 | ||
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Colony formation assays | |||
Mechanism Description | piR-54265 binds PIWIL2 promotes CRC cell proliferation and invasiveness and 5-FU and oxaliplatin resistance via promoting oncogenic STAT3 signaling. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.