Molecule Information

General Information of the Molecule (ID: Mol01775)

• Name: hsa-miR-6886-3p ,Homo sapiens
• Synonyms: microRNA 6886
• Molecule Type: Mature miRNA
• Sequence: UGCCCUUCUCUCCUCCUGCCU
• Ensembl ID: ENSG00000284553
• HGNC ID: HGNC:50121
• Mature Accession: MIMAT0027673

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• In Vitro Model: PLC cells; Liver; Homo sapiens (Human); CVCL_0485
• In Vitro Model: L02 cells; Liver; Homo sapiens (Human); CVCL_6926
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR6825-5p, miR6845-5p and miR6886-3p could decrease the level of USP22 protein by binding to the 3'-untranlated region of USP22 mRNA. All the three microRNAs (miRNAs) were downregulated by HULC, which resulted in the elevation of USP22. The pathway 'HULC/USP22/Sirt1/ protective autophagy' attenuates the sensitivity of HCC cells to chemotherapeutic agents.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• In Vitro Model: PLC cells; Liver; Homo sapiens (Human); CVCL_0485
• In Vitro Model: L02 cells; Liver; Homo sapiens (Human); CVCL_6926
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR6825-5p, miR6845-5p and miR6886-3p could decrease the level of USP22 protein by binding to the 3'-untranlated region of USP22 mRNA. All the three microRNAs (miRNAs) were downregulated by HULC, which resulted in the elevation of USP22. The pathway 'HULC/USP22/Sirt1/ protective autophagy' attenuates the sensitivity of HCC cells to chemotherapeutic agents.

Pirarubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Pirarubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• In Vitro Model: PLC cells; Liver; Homo sapiens (Human); CVCL_0485
• In Vitro Model: L02 cells; Liver; Homo sapiens (Human); CVCL_6926
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR6825-5p, miR6845-5p and miR6886-3p could decrease the level of USP22 protein by binding to the 3'-untranlated region of USP22 mRNA. All the three microRNAs (miRNAs) were downregulated by HULC, which resulted in the elevation of USP22. The pathway 'HULC/USP22/Sirt1/ protective autophagy' attenuates the sensitivity of HCC cells to chemotherapeutic agents.

References

• Ref 1: LncRNA HULC triggers autophagy via stabilizing Sirt1 and attenuates the chemosensitivity of HCC cells. Oncogene. 2017 Jun 22;36(25):3528-3540. doi: 10.1038/onc.2016.521. Epub 2017 Feb 6.