Molecule Information
General Information of the Molecule (ID: Mol01775)
Name |
hsa-miR-6886-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 6886
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UGCCCUUCUCUCCUCCUGCCU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [1] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
SMMC7721 cells | Uterus | Homo sapiens (Human) | CVCL_0534 | |
PLC cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
L02 cells | Liver | Homo sapiens (Human) | CVCL_6926 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR6825-5p, miR6845-5p and miR6886-3p could decrease the level of USP22 protein by binding to the 3'-untranlated region of USP22 mRNA. All the three microRNAs (miRNAs) were downregulated by HULC, which resulted in the elevation of USP22. The pathway 'HULC/USP22/Sirt1/ protective autophagy' attenuates the sensitivity of HCC cells to chemotherapeutic agents. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [1] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
SMMC7721 cells | Uterus | Homo sapiens (Human) | CVCL_0534 | |
PLC cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
L02 cells | Liver | Homo sapiens (Human) | CVCL_6926 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR6825-5p, miR6845-5p and miR6886-3p could decrease the level of USP22 protein by binding to the 3'-untranlated region of USP22 mRNA. All the three microRNAs (miRNAs) were downregulated by HULC, which resulted in the elevation of USP22. The pathway 'HULC/USP22/Sirt1/ protective autophagy' attenuates the sensitivity of HCC cells to chemotherapeutic agents. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [1] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Pirarubicin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
SMMC7721 cells | Uterus | Homo sapiens (Human) | CVCL_0534 | |
PLC cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
L02 cells | Liver | Homo sapiens (Human) | CVCL_6926 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR6825-5p, miR6845-5p and miR6886-3p could decrease the level of USP22 protein by binding to the 3'-untranlated region of USP22 mRNA. All the three microRNAs (miRNAs) were downregulated by HULC, which resulted in the elevation of USP22. The pathway 'HULC/USP22/Sirt1/ protective autophagy' attenuates the sensitivity of HCC cells to chemotherapeutic agents. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.