Molecule Information

General Information of the Molecule (ID: Mol01770)

Name	hsa-miR-1229-5p ,Homo sapiens
Synonyms	microRNA 1229 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	GUGGGUAGGGUUUGGGGGAGAGCG Click to Show/Hide
Ensembl ID	ENSG00000221394
HGNC ID	HGNC:33924
Mature Accession	MIMAT0022942
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Fluorouracil

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Regulation by the Disease Microenvironment (RTDM)			Click to Show/Hide
Disease Class: Colorectal cancer				[1]
Resistant Disease	Colorectal cancer [ICD-11: 2B91.1]			Disease Info
Resistant Drug	Fluorouracil			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	PTEN/AKT signaling pathway		Regulation	hsa05235
In Vitro Model	SW480 cells	Colon	Homo sapiens (Human)	CVCL_0546
	HCT116 cells	Colon	Homo sapiens (Human)	CVCL_0291
	HCT-8 cells	Colon	Homo sapiens (Human)	CVCL_2478
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	miR-1246, miR-21-5p, miR-96-5p and miR-1229-5p from serum exosomes involved in chemotherapy resistance may be new therapeutic targets, downregulating these miRNAs may promote CRC cell sensitivity to chemotherapeutic drugs.

Oxaliplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Regulation by the Disease Microenvironment (RTDM)			Click to Show/Hide
Disease Class: Colorectal cancer				[1]
Resistant Disease	Colorectal cancer [ICD-11: 2B91.1]			Disease Info
Resistant Drug	Oxaliplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	PTEN/AKT signaling pathway		Regulation	hsa05235
In Vitro Model	SW480 cells	Colon	Homo sapiens (Human)	CVCL_0546
	HCT116 cells	Colon	Homo sapiens (Human)	CVCL_0291
	HCT-8 cells	Colon	Homo sapiens (Human)	CVCL_2478
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	miR-1246, miR-21-5p, miR-96-5p and miR-1229-5p from serum exosomes involved in chemotherapy resistance may be new therapeutic targets, downregulating these miRNAs may promote CRC cell sensitivity to chemotherapeutic drugs.

References

Ref 1	A panel of serum exosomal microRNAs as predictive markers for chemoresistance in advanced colorectal cancer. Cancer Chemother Pharmacol. 2019 Aug;84(2):315-325. doi: 10.1007/s00280-019-03867-6. Epub 2019 May 14.