Molecule Information
General Information of the Molecule (ID: Mol01770)
Name |
hsa-miR-1229-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 1229
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
GUGGGUAGGGUUUGGGGGAGAGCG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [1] | |||
Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | PTEN/AKT signaling pathway | Regulation | hsa05235 | |
In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
HCT-8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR-1246, miR-21-5p, miR-96-5p and miR-1229-5p from serum exosomes involved in chemotherapy resistance may be new therapeutic targets, downregulating these miRNAs may promote CRC cell sensitivity to chemotherapeutic drugs. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [1] | |||
Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Resistant Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | PTEN/AKT signaling pathway | Regulation | hsa05235 | |
In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
HCT-8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR-1246, miR-21-5p, miR-96-5p and miR-1229-5p from serum exosomes involved in chemotherapy resistance may be new therapeutic targets, downregulating these miRNAs may promote CRC cell sensitivity to chemotherapeutic drugs. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.