General Information of the Molecule (ID: Mol01767)
Name
hsa-miR-1268b ,Homo sapiens
Synonyms
microRNA 1268b
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CGGGCGUGGUGGUGGGGGUG
    Click to Show/Hide
Ensembl ID
ENSG00000265561
HGNC ID
HGNC:41581
Mature Accession
MIMAT0018925
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
MDA-MB-453 cells Breast Homo sapiens (Human) CVCL_0418
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometric analysis; Transwell invasion assay
Mechanism Description miR1268b confers chemosensitivity in breast cancer by targeting ERBB2-mediated PI3k-AkT pathway. miR1268b could repress the PI3k-AkT signaling pathway by targeting ERBB2 and inhibit the anti-apoptosis protein Bcl2.
References
Ref 1 MiR-1268b confers chemosensitivity in breast cancer by targeting ERBB2-mediated PI3K-AKT pathway. Oncotarget. 2017 Aug 9;8(52):89631-89642. doi: 10.18632/oncotarget.20099. eCollection 2017 Oct 27.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.