Molecule Information

General Information of the Molecule (ID: Mol01767)

• Name: hsa-miR-1268b ,Homo sapiens
• Synonyms: microRNA 1268b
• Molecule Type: Mature miRNA
• Sequence: CGGGCGUGGUGGUGGGGGUG
• Ensembl ID: ENSG00000265561
• HGNC ID: HGNC:41581
• Mature Accession: MIMAT0018925

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-453 cells; Breast; Homo sapiens (Human); CVCL_0418
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis; Transwell invasion assay
• Mechanism Description: miR1268b confers chemosensitivity in breast cancer by targeting ERBB2-mediated PI3k-AkT pathway. miR1268b could repress the PI3k-AkT signaling pathway by targeting ERBB2 and inhibit the anti-apoptosis protein Bcl2.

References

• Ref 1: MiR-1268b confers chemosensitivity in breast cancer by targeting ERBB2-mediated PI3K-AKT pathway. Oncotarget. 2017 Aug 9;8(52):89631-89642. doi: 10.18632/oncotarget.20099. eCollection 2017 Oct 27.