Molecule Information

General Information of the Molecule (ID: Mol01765)

• Name: hsa-miR-3609 ,Homo sapiens
• Synonyms: microRNA 3609
• Molecule Type: Mature miRNA
• Sequence: CAAAGUGAUGAGUAAUACUGGCUG
• Ensembl ID: ENSG00000266019
• HGNC ID: HGNC:38956
• Mature Accession: MIMAT0017986

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vivo Model: BALB/c mouse model; Mus musculus
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Transfection of a miR-3609 mimic markedly suppressed PD-L1 protein expression in MDA-MB-231 and MDA-MB-468 cells in a dose-dependent manner and increased the sensitivity of MCF7/ADR cells to adriamycin, whereas transfection of a miR-3609 inhibitor enhanced PD-L1 protein expression in HBL-100 and MCF-7 cells.

References

• Ref 1: miR3609 sensitizes breast cancer cells to adriamycin by blocking the programmed death-ligand 1 immune checkpoint. Exp Cell Res. 2019 Jul 1;380(1):20-28. doi: 10.1016/j.yexcr.2019.03.025. Epub 2019 Mar 20.