General Information of the Molecule (ID: Mol01764)
Name
hsa-miR-3190-5p ,Homo sapiens
Synonyms
microRNA 3190
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UCUGGCCAGCUACGUCCCCA
    Click to Show/Hide
Ensembl ID
ENSG00000265134
HGNC ID
HGNC:38190
Mature Accession
MIMAT0015073
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
CHO cells Ovary Homo sapiens (Human) CVCL_0213
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The expression of ABCC4 was inhibited by miR3190-5p through binding to the 3'-UTR of the ABCC4 gene, this regulatory role of miR3190-5p was disrupted by rs3742106. The rs3742106 T allele offers a binding-site for miR3190-5p, which results in low-expression of ABCC4, increased intracellular concentration of 5-FU, and enhanced sensitivity to 5-FU treatment.
References
Ref 1 A polymorphism in ABCC4 is related to efficacy of 5-FU/capecitabine-based chemotherapy in colorectal cancer patients. Sci Rep. 2017 Aug 1;7(1):7059. doi: 10.1038/s41598-017-07491-3.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.