Molecule Information

General Information of the Molecule (ID: Mol01764)

• Name: hsa-miR-3190-5p ,Homo sapiens
• Synonyms: microRNA 3190
• Molecule Type: Mature miRNA
• Sequence: UCUGGCCAGCUACGUCCCCA
• Ensembl ID: ENSG00000265134
• HGNC ID: HGNC:38190
• Mature Accession: MIMAT0015073

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [1]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: CHO cells; Ovary; Homo sapiens (Human); CVCL_0213
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The expression of ABCC4 was inhibited by miR3190-5p through binding to the 3'-UTR of the ABCC4 gene, this regulatory role of miR3190-5p was disrupted by rs3742106. The rs3742106 T allele offers a binding-site for miR3190-5p, which results in low-expression of ABCC4, increased intracellular concentration of 5-FU, and enhanced sensitivity to 5-FU treatment.

References

• Ref 1: A polymorphism in ABCC4 is related to efficacy of 5-FU/capecitabine-based chemotherapy in colorectal cancer patients. Sci Rep. 2017 Aug 1;7(1):7059. doi: 10.1038/s41598-017-07491-3.