Molecule Information
General Information of the Molecule (ID: Mol01763)
| Name |
hsa-miR-3188
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 3188
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
AGAGGCUUUGUGCGGAUACGGGG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Nasopharyngeal carcinoma [ICD-11: 2B6B.0] | [1] | |||
| Sensitive Disease | Nasopharyngeal carcinoma [ICD-11: 2B6B.0] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| PI3K/AKT/mTOR signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | HNE1 cells | Nasopharynx | Homo sapiens (Human) | CVCL_0308 |
| 5-8F cells | Nasopharynx | Homo sapiens (Human) | CVCL_C528 | |
| CNE2 cells | Nasopharynx | Homo sapiens (Human) | CVCL_6889 | |
| C666-1 cells | Throat | Homo sapiens (Human) | CVCL_7949 | |
| CNE1 cells | Throat | Homo sapiens (Human) | CVCL_6888 | |
| HONE1 cells | Throat | Homo sapiens (Human) | CVCL_8706 | |
| 6-10B cells | Nasopharynx | Homo sapiens (Human) | CVCL_C529 | |
| SUNE-1 cells | Nasopharynx | Homo sapiens (Human) | CVCL_6946 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-3188 regulates nasopharyngeal carcinoma proliferation and chemosensitivity through a FOXO1-modulated positive feedback loop with mTOR-p-PI3k/AkT-c-JUN. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
