Molecule Information

General Information of the Molecule (ID: Mol01763)

• Name: hsa-miR-3188 ,Homo sapiens
• Synonyms: microRNA 3188
• Molecule Type: Mature miRNA
• Sequence: AGAGGCUUUGUGCGGAUACGGGG
• Ensembl ID: ENSG00000267959
• HGNC ID: HGNC:38226
• Mature Accession: MIMAT0015070

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Nasopharyngeal carcinoma [1]

• Sensitive Disease: Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT/mTOR signaling pathway; Inhibition; hsa04151
• In Vitro Model: HNE1 cells; Nasopharynx; Homo sapiens (Human); CVCL_0308
• In Vitro Model: 5-8F cells; Nasopharynx; Homo sapiens (Human); CVCL_C528
• In Vitro Model: CNE2 cells; Nasopharynx; Homo sapiens (Human); CVCL_6889
• In Vitro Model: C666-1 cells; Throat; Homo sapiens (Human); CVCL_7949
• In Vitro Model: CNE1 cells; Throat; Homo sapiens (Human); CVCL_6888
• In Vitro Model: HONE1 cells; Throat; Homo sapiens (Human); CVCL_8706
• In Vitro Model: 6-10B cells; Nasopharynx; Homo sapiens (Human); CVCL_C529
• In Vitro Model: SUNE-1 cells; Nasopharynx; Homo sapiens (Human); CVCL_6946
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-3188 regulates nasopharyngeal carcinoma proliferation and chemosensitivity through a FOXO1-modulated positive feedback loop with mTOR-p-PI3k/AkT-c-JUN.

References

• Ref 1: miR-3188 regulates nasopharyngeal carcinoma proliferation and chemosensitivity through a FOXO1-modulated positive feedback loop with mTOR-p-PI3K/AKT-c-JUN. Nat Commun. 2016 Apr 20;7:11309. doi: 10.1038/ncomms11309.