Molecule Information

General Information of the Molecule (ID: Mol01759)

Name	hsa-miR-761 ,Homo sapiens
Synonyms	microRNA 761 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	GCAGCAGGGUGAAACUGACACA Click to Show/Hide
Ensembl ID	ENSG00000283899
HGNC ID	HGNC:37305
Mature Accession	MIMAT0010364
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Fluorouracil

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Colorectal cancer				[1]
Sensitive Disease	Colorectal cancer [ICD-11: 2B91.1]			Disease Info
Sensitive Drug	Fluorouracil			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell viability		Inhibition	hsa05200
In Vitro Model	HT29 Cells	Colon	Homo sapiens (Human)	CVCL_A8EZ
	SW480 cells	Colon	Homo sapiens (Human)	CVCL_0546
	DLD1 cells	Colon	Homo sapiens (Human)	CVCL_0248
	SW620 cells	Colon	Homo sapiens (Human)	CVCL_0547
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	miR-761 suppressed colorectal cancer cell proliferation and invasion by downregulating FOXM1.

Pazopanib HCl

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Synovial sarcoma				[2]
Resistant Disease	Synovial sarcoma [ICD-11: 2B5A.0]			Disease Info
Resistant Drug	Pazopanib HCl			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	1273/99 cells	Sarcoma	Homo sapiens (Human)	CVCL_N588
	HS-SYII cells	Sarcoma	Homo sapiens (Human)	CVCL_8719
	SYO-1 cells	Sarcoma	Homo sapiens (Human)	CVCL_7146
	YaFuSS cells	Sarcoma	Homo sapiens (Human)	CVCL_L809
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	EV isolation, immunoblotting, and nanoparticle tracking analysis
Mechanism Description	Extracellular vesicle-encapsulated microRNA-761 enhances pazopanib resistance in synovial sarcoma by down-regulating TRIP6, LMNA, and SIRT3 expression.

References

Ref 1	MicroRNA-761 promotes the sensitivity of colorectal cancer cells to 5-Fluorouracil through targeting FOXM1. Oncotarget. 2017 Aug 10;9(1):321-331. doi: 10.18632/oncotarget.20109. eCollection 2018 Jan 2.
Ref 2	Extracellular vesicle-encapsulated microRNA-761 enhances pazopanib resistance in synovial sarcoma. Biochem Biophys Res Commun. 2018 Jan 1;495(1):1322-1327. doi: 10.1016/j.bbrc.2017.11.164. Epub 2017 Nov 27.