Molecule Information
General Information of the Molecule (ID: Mol01759)
| Name |
hsa-miR-761
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 761
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
GCAGCAGGGUGAAACUGACACA
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [1] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell viability | Inhibition | hsa05200 | |
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
| DLD1 cells | Colon | Homo sapiens (Human) | CVCL_0248 | |
| SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-761 suppressed colorectal cancer cell proliferation and invasion by downregulating FOXM1. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Malignant glioma [ICD-11: 2A00.02] | [2] | |||
| Resistant Disease | Malignant glioma [ICD-11: 2A00.02] | |||
| Resistant Drug | Pazopanib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SYO-1 cells | Sarcoma | Homo sapiens (Human) | CVCL_7146 |
| HS-SYII cells | Sarcoma | Homo sapiens (Human) | CVCL_8719 | |
| YaFuSS cells | Sarcoma | Homo sapiens (Human) | CVCL_L809 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Mechanism Description | We performed a comprehensive analysis of secreted miRNA abundance in pazopanib treated/untreated synovial sarcoma cells from four different cell lines (SYO-1, HS-SYII, 1273/99, and YaFuSS) using microarray technology, and discovered miR-761 in EVs as a potential biomarker of pazopanib-resistance in synovial sarcoma. Furthermore, we showed that miR-761 putatively targeted three proteins, thyroid hormone receptor interactor 6 (TRIP6), lamin A/C (LMNA), and NAD-dependent protein deacetylase sirtuin-3 (SIRT3). Knockdown of any of these proteins was shown in previous studies to confer increased resistance to chemotherapeutic agents. Our findings provide new insight into the potential role of miR-761, an EV-secreted miRNA from synovial sarcoma cells, making it a potential candidate for use in sarcoma therapy in the future. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Synovial sarcoma [ICD-11: 2B5A.0] | [3] | |||
| Resistant Disease | Synovial sarcoma [ICD-11: 2B5A.0] | |||
| Resistant Drug | Pazopanib HCl | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | 1273/99 cells | Sarcoma | Homo sapiens (Human) | CVCL_N588 |
| HS-SYII cells | Sarcoma | Homo sapiens (Human) | CVCL_8719 | |
| SYO-1 cells | Sarcoma | Homo sapiens (Human) | CVCL_7146 | |
| YaFuSS cells | Sarcoma | Homo sapiens (Human) | CVCL_L809 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
EV isolation, immunoblotting, and nanoparticle tracking analysis | |||
| Mechanism Description | Extracellular vesicle-encapsulated microRNA-761 enhances pazopanib resistance in synovial sarcoma by down-regulating TRIP6, LMNA, and SIRT3 expression. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
