Molecule Information
General Information of the Molecule (ID: Mol01759)
Name |
hsa-miR-761
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 761
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
GCAGCAGGGUGAAACUGACACA
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [1] | |||
Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell viability | Inhibition | hsa05200 | |
In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
DLD1 cells | Colon | Homo sapiens (Human) | CVCL_0248 | |
SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-761 suppressed colorectal cancer cell proliferation and invasion by downregulating FOXM1. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Synovial sarcoma | [2] | |||
Resistant Disease | Synovial sarcoma [ICD-11: 2B5A.0] | |||
Resistant Drug | Pazopanib HCl | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | 1273/99 cells | Sarcoma | Homo sapiens (Human) | CVCL_N588 |
HS-SYII cells | Sarcoma | Homo sapiens (Human) | CVCL_8719 | |
SYO-1 cells | Sarcoma | Homo sapiens (Human) | CVCL_7146 | |
YaFuSS cells | Sarcoma | Homo sapiens (Human) | CVCL_L809 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
EV isolation, immunoblotting, and nanoparticle tracking analysis | |||
Mechanism Description | Extracellular vesicle-encapsulated microRNA-761 enhances pazopanib resistance in synovial sarcoma by down-regulating TRIP6, LMNA, and SIRT3 expression. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.