Molecule Information

General Information of the Molecule (ID: Mol01758)

• Name: hsa-miR-224-3p ,Homo sapiens
• Synonyms: microRNA 224
• Molecule Type: Mature miRNA
• Sequence: AAAAUGGUGCCCUAGUGACUACA
• Ensembl ID: ENSG00000284363
• HGNC ID: HGNC:31604
• Mature Accession: MIMAT0009198

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Increased fucosylation has a pivotal role in multidrug resistance of breast cancer cells through miR-224-3p targeting FUT4.

References

• Ref 1: Increased fucosylation has a pivotal role in multidrug resistance of breast cancer cells through miR-224-3p targeting FUT4. Gene. 2016 Mar 10;578(2):232-41. doi: 10.1016/j.gene.2015.12.028. Epub 2015 Dec 14.