General Information of the Molecule (ID: Mol01757)
Name
hsa-miR-1284 ,Homo sapiens
Synonyms
microRNA 1284
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UCUAUACAGACCCUGGCUUUUC
    Click to Show/Hide
Ensembl ID
ENSG00000221264
HGNC ID
HGNC:35362
Mature Accession
MIMAT0005941
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Cervical cancer [1]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell colony Inhibition hsa05200
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell viability Inhibition hsa05200
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Siha cells Cervix uteri Homo sapiens (Human) CVCL_0032
C33A cells Uterus Homo sapiens (Human) CVCL_1094
MS751 cells Cervical Homo sapiens (Human) CVCL_4996
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay; Transwell assay
Mechanism Description miR-1284 enhances sensitivity of cervical cancer cells to cisplatin via downregulating HMGB1.
Vincristine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [2]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-1284 overexpression can regulate the response of SGC7901/VCR cells to chemotherapeutic resistance by targeting EIF4A1, reducing JUN and MMP12, and increasing MYC.
References
Ref 1 MiR-1284 enhances sensitivity of cervical cancer cells to cisplatin via downregulating HMGB1. Biomed Pharmacother. 2018 Nov;107:997-1003. doi: 10.1016/j.biopha.2018.08.059. Epub 2018 Aug 23.
Ref 2 MiR-1284 modulates multidrug resistance of gastric cancer cells by targeting EIF4A1. Oncol Rep. 2016 May;35(5):2583-91. doi: 10.3892/or.2016.4643. Epub 2016 Feb 29.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.