Molecule Information

General Information of the Molecule (ID: Mol01757)

• Name: hsa-miR-1284 ,Homo sapiens
• Synonyms: microRNA 1284
• Molecule Type: Mature miRNA
• Sequence: UCUAUACAGACCCUGGCUUUUC
• Ensembl ID: ENSG00000221264
• HGNC ID: HGNC:35362
• Mature Accession: MIMAT0005941

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [1]

• Sensitive Disease: Cervical cancer [ICD-11: 2C77.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• In Vitro Model: C33A cells; Uterus; Homo sapiens (Human); CVCL_1094
• In Vitro Model: MS751 cells; Cervical; Homo sapiens (Human); CVCL_4996
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay; Transwell assay
• Mechanism Description: miR-1284 enhances sensitivity of cervical cancer cells to cisplatin via downregulating HMGB1.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-1284 overexpression can regulate the response of SGC7901/VCR cells to chemotherapeutic resistance by targeting EIF4A1, reducing JUN and MMP12, and increasing MYC.

References

• Ref 1: MiR-1284 enhances sensitivity of cervical cancer cells to cisplatin via downregulating HMGB1. Biomed Pharmacother. 2018 Nov;107:997-1003. doi: 10.1016/j.biopha.2018.08.059. Epub 2018 Aug 23.
• Ref 2: MiR-1284 modulates multidrug resistance of gastric cancer cells by targeting EIF4A1. Oncol Rep. 2016 May;35(5):2583-91. doi: 10.3892/or.2016.4643. Epub 2016 Feb 29.