Molecule Information
General Information of the Molecule (ID: Mol01751)
Name |
hsa-miR-1291
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 1291
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UGGCCCUGACUGAAGACCAGCAGU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Pancreatic carcinoma | [1] | |||
Sensitive Disease | Pancreatic carcinoma [ICD-11: 2C10.2] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell growth | Inhibition | hsa05200 | |
In Vitro Model | H69 cells | Lung | Homo sapiens (Human) | CVCL_8121 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Hsa-miR-1291-directed downregulation of ABCC1 led to a greater intracellular drug accumulation and sensitized the cells to doxorubicin. | |||
Disease Class: Lung small cell carcinoma | [1] | |||
Sensitive Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell growth | Inhibition | hsa05200 | |
In Vitro Model | PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Hsa-miR-1291-directed downregulation of ABCC1 led to a greater intracellular drug accumulation and sensitized the cells to doxorubicin. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.