Molecule Information

General Information of the Molecule (ID: Mol01750)

• Name: hsa-miR-1207-5p ,Homo sapiens
• Synonyms: microRNA 1207
• Molecule Type: Mature miRNA
• Sequence: UGGCAGGGAGGCUGGGAGGGG
• Ensembl ID: ENSG00000221176
• HGNC ID: HGNC:35273
• Mature Accession: MIMAT0005871

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [1]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: Capan-1 cells; Pancreas; Homo sapiens (Human); CVCL_0237
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• In Vitro Model: Su.86.86 cells; Pancreas; Homo sapiens (Human); CVCL_3881
• In Vivo Model: Engrafted tumor mouse model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: Overexpression of the miR-1207 pair improves gemcitabine efficacy in PC cells.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Triple negative breast cancer [ICD-11: 2C60.9] [2]

• Resistant Disease: Triple negative breast cancer [ICD-11: 2C60.9]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-436 cells; Breast; Homo sapiens (Human); CVCL_0623
• In Vitro Model: MDA-MB-453 cells; Breast; Homo sapiens (Human); CVCL_0418
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-1207-5p induces the resistence of triple-negative breast cancer cells to Taxol treatment via the suppression of LZTS1 expression.

References

• Ref 1: Gemcitabine exhibits a suppressive effect on pancreatic cancer cell growth by regulating processing of PVT1 to miR1207. Mol Oncol. 2018 Dec;12(12):2147-2164. doi: 10.1002/1878-0261.12393. Epub 2018 Oct 30.
• Ref 2: miR-1207-5p regulates the sensitivity of triple-negative breast cancer cells to Taxol treatment via the suppression of LZTS1 expression. Oncol Lett. 2019 Jan;17(1):990-998. doi: 10.3892/ol.2018.9687. Epub 2018 Nov 12.