Molecule Information
General Information of the Molecule (ID: Mol01747)
| Name |
hsa-miR-1183
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 1183
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
CACUGUAGGUGAUGGUGAGAGUGGGCA
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [1] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Resistant Drug | Erlotinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
| Cell proliferation | Activation | hsa05200 | ||
| miR1183/PDPk1 signaling pathway | Activation | hsa05206 | ||
| In Vitro Model | H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| HCC827 cells | Lung | Homo sapiens (Human) | CVCL_2063 | |
| NCI-H358 cells | Lung | Homo sapiens (Human) | CVCL_1559 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Colony formation assay | |||
| Mechanism Description | Hsa_circ_0004015 formed by CDk14 gene inhibited the expression of miR-1183, which could disinhibit the PDPk1 expression from miR-1183, ultimately resulted in the promotion of cell proliferation, invasion, and TkI inhibitor drug resistance of NSCLC cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [1] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Resistant Drug | Gefitinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
| Cell proliferation | Activation | hsa05200 | ||
| miR1183/PDPk1 signaling pathway | Activation | hsa05206 | ||
| In Vitro Model | H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| HCC827 cells | Lung | Homo sapiens (Human) | CVCL_2063 | |
| NCI-H358 cells | Lung | Homo sapiens (Human) | CVCL_1559 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Colony formation assay | |||
| Mechanism Description | Hsa_circ_0004015 formed by CDk14 gene inhibited the expression of miR-1183, which could disinhibit the PDPk1 expression from miR-1183, ultimately resulted in the promotion of cell proliferation, invasion, and TkI inhibitor drug resistance of NSCLC cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [1] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Resistant Drug | Icotinib hydrochloride | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
| Cell proliferation | Activation | hsa05200 | ||
| miR1183/PDPk1 signaling pathway | Activation | hsa05206 | ||
| In Vitro Model | H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| HCC827 cells | Lung | Homo sapiens (Human) | CVCL_2063 | |
| NCI-H358 cells | Lung | Homo sapiens (Human) | CVCL_1559 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Colony formation assay | |||
| Mechanism Description | Hsa_circ_0004015 formed by CDk14 gene inhibited the expression of miR-1183, which could disinhibit the PDPk1 expression from miR-1183, ultimately resulted in the promotion of cell proliferation, invasion, and TkI inhibitor drug resistance of NSCLC cells. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
