Molecule Information
General Information of the Molecule (ID: Mol01747)
Name |
hsa-miR-1183
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 1183
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
CACUGUAGGUGAUGGUGAGAGUGGGCA
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [1] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | Erlotinib | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
Cell proliferation | Activation | hsa05200 | ||
miR1183/PDPk1 signaling pathway | Activation | hsa05206 | ||
In Vitro Model | H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 |
A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
HCC827 cells | Lung | Homo sapiens (Human) | CVCL_2063 | |
NCI-H358 cells | Lung | Homo sapiens (Human) | CVCL_1559 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Colony formation assay | |||
Mechanism Description | Hsa_circ_0004015 formed by CDk14 gene inhibited the expression of miR-1183, which could disinhibit the PDPk1 expression from miR-1183, ultimately resulted in the promotion of cell proliferation, invasion, and TkI inhibitor drug resistance of NSCLC cells. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [1] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | Gefitinib | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
Cell proliferation | Activation | hsa05200 | ||
miR1183/PDPk1 signaling pathway | Activation | hsa05206 | ||
In Vitro Model | H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 |
A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
HCC827 cells | Lung | Homo sapiens (Human) | CVCL_2063 | |
NCI-H358 cells | Lung | Homo sapiens (Human) | CVCL_1559 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Colony formation assay | |||
Mechanism Description | Hsa_circ_0004015 formed by CDk14 gene inhibited the expression of miR-1183, which could disinhibit the PDPk1 expression from miR-1183, ultimately resulted in the promotion of cell proliferation, invasion, and TkI inhibitor drug resistance of NSCLC cells. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [1] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | Icotinib hydrochloride | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
Cell proliferation | Activation | hsa05200 | ||
miR1183/PDPk1 signaling pathway | Activation | hsa05206 | ||
In Vitro Model | H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 |
A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
HCC827 cells | Lung | Homo sapiens (Human) | CVCL_2063 | |
NCI-H358 cells | Lung | Homo sapiens (Human) | CVCL_1559 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Colony formation assay | |||
Mechanism Description | Hsa_circ_0004015 formed by CDk14 gene inhibited the expression of miR-1183, which could disinhibit the PDPk1 expression from miR-1183, ultimately resulted in the promotion of cell proliferation, invasion, and TkI inhibitor drug resistance of NSCLC cells. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.