Molecule Information
General Information of the Molecule (ID: Mol01745)
Name |
hsa-miR-320c
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 320c-1
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AAAAGCUGGGUUGAGAGGGU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Pancreatic cancer | [1] | |||
Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
Resistant Drug | Gemcitabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
In Vitro Model | MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 |
PSN1 cells | Pancreas | Homo sapiens (Human) | CVCL_1644 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-320c regulates the resistance of pancreatic cancer cells to gemcitabine through SMARCC1. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.