Molecule Information

General Information of the Molecule (ID: Mol01741)

Name	hsa-miR-301b-3p ,Homo sapiens
Synonyms	microRNA 301b Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	CAGUGCAAUGAUAUUGUCAAAGC Click to Show/Hide
Ensembl ID	ENSG00000212102
HGNC ID	HGNC:33667
Mature Accession	MIMAT0004958
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Non-small cell lung cancer				[1]
Resistant Disease	Non-small cell lung cancer [ICD-11: 2C25.Y]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell migration		Activation	hsa04670
	Cell proliferation		Activation	hsa05200
	TGF-beta signaling pathway		Inhibition	hsa04350
In Vitro Model	A549 cells	Lung	Homo sapiens (Human)	CVCL_0023
In Vivo Model	BALB/c nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay; Colony formation assay; Flow cytometry assay
Mechanism Description	LncRNA MBNL1-AS1 restoration could decelerate the occurrence and progression of NSCLC, thereby highlighting the functionality of LncRNA MBNL1-AS1 restoration as a sponge of miR-301b-3p to suppress the proliferation, invasion, drug resistance, and sphere formation of CSC cells in NSCLC via upregulation of TGFBR2.

Gefitinib

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Non-small cell lung cancer				[1]
Resistant Disease	Non-small cell lung cancer [ICD-11: 2C25.Y]			Disease Info
Resistant Drug	Gefitinib			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell migration		Activation	hsa04670
	Cell proliferation		Activation	hsa05200
	TGF-beta signaling pathway		Inhibition	hsa04350
In Vitro Model	A549 cells	Lung	Homo sapiens (Human)	CVCL_0023
In Vivo Model	BALB/c nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay; Colony formation assay; Flow cytometry assay
Mechanism Description	LncRNA MBNL1-AS1 restoration could decelerate the occurrence and progression of NSCLC, thereby highlighting the functionality of LncRNA MBNL1-AS1 restoration as a sponge of miR-301b-3p to suppress the proliferation, invasion, drug resistance, and sphere formation of CSC cells in NSCLC via upregulation of TGFBR2.

References

Ref 1	microRNA-301b-3p downregulation underlies a novel inhibitory role of long non-coding RNA MBNL1-AS1 in non-small cell lung cancer. Stem Cell Res Ther. 2019 May 21;10(1):144. doi: 10.1186/s13287-019-1235-8.