General Information of the Molecule (ID: Mol01740)
Name
hsa-miR-760 ,Homo sapiens
Synonyms
microRNA 760
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CGGCUCUGGGUCUGUGGGGA
    Click to Show/Hide
Ensembl ID
ENSG00000211575
HGNC ID
HGNC:33666
Mature Accession
MIMAT0004957
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [1], [2]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation TGF-beta/Wnt/G protein signaling pathway Regulation hsa04010
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Compared to the breast cancer tissues from chemotherapy responders, 10 miRNAs were identified to be dysregulated in the chemoresistant breast cancer tissues. Three of these miRNAs were up-regulated (miR-141, miR-200c, and miR-31), and 7 were down-regulated (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760). And miR-760 downregulation can enhance glioblastoma cells resistance to temozolomide through TGF-beta signaling pathway.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [3]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell viability Inhibition hsa05200
Notch1/HES1-PTEN/AKT signaling pathway Regulation hsa04330
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
SMMC7721 cells Uterus Homo sapiens (Human) CVCL_0534
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay; Caspase-3 Activity kit assay
Mechanism Description miR-760 inhibits Dox-resistance in HCC cells through inhibiting Notch1 and promoting PTEN expression.
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Breast cancer [4]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Epithelial mesenchymal transition signaling pathway Inhibition hsa01521
In Vitro Model MCF-7/DOX cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR760 mediates chemoresistance through inhibition of epithelial mesenchymal transition in breast cancer cells, overexpression of miR760 suppressed the expression of Nanog, a transcriptional factor involved in chemoresistance, and resulted in the reversal of EMT in breast cancer cells.
References
Ref 1 miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother. 2014 Oct;68(8):935-42. doi: 10.1016/j.biopha.2014.09.011. Epub 2014 Oct 5.
Ref 2 Systematic analysis of gene expression pattern in has-miR-760 overexpressed resistance of the MCF-7 human breast cancer cell to doxorubicin. Biomed Pharmacother. 2015 Feb;69:162-9. doi: 10.1016/j.biopha.2014.11.028. Epub 2014 Nov 25.
Ref 3 MicroRNA-760 Inhibits Doxorubicin Resistance in Hepatocellular Carcinoma through Regulating Notch1/Hes1-PTEN/Akt Signaling Pathway. J Biochem Mol Toxicol. 2018 Aug;32(8):e22167. doi: 10.1002/jbt.22167. Epub 2018 Jul 3.
Ref 4 miR-760 mediates chemoresistance through inhibition of epithelial mesenchymal transition in breast cancer cells. Eur Rev Med Pharmacol Sci. 2016 Dec;20(23):5002-5008.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.