Molecule Information

General Information of the Molecule (ID: Mol01738)

• Name: hsa-miR-708-3p ,Homo sapiens
• Synonyms: microRNA 708
• Molecule Type: Mature miRNA
• Sequence: CAACUAGACUGUGAGCUUCUAG
• Ensembl ID: ENSG00000211997
• HGNC ID: HGNC:33654
• Mature Accession: MIMAT0004927

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vitro Model: MCF10A cells; Breast; Homo sapiens (Human); CVCL_0598
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR-708-3p dramatically inhibits breast cancer cell lung metastasis and the expression of ZEB1, CDH2 and vimentin was significantly decreased in miR-708-3p-overexpressing cells at both the mRNA and protein levels compared to that in vector control cells.

References

• Ref 1: MicroRNA-708-3p mediates metastasis and chemoresistance through inhibition of epithelial-to-mesenchymal transition in breast cancer. Cancer Sci. 2018 May;109(5):1404-1413. doi: 10.1111/cas.13588. Epub 2018 Apr 29.