Molecule Information
General Information of the Molecule (ID: Mol01738)
Name |
hsa-miR-708-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 708
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
CAACUAGACUGUGAGCUUCUAG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [1] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
MDA-MB-468 cells | Breast | Homo sapiens (Human) | CVCL_0419 | |
MCF10A cells | Breast | Homo sapiens (Human) | CVCL_0598 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Overexpression of miR-708-3p dramatically inhibits breast cancer cell lung metastasis and the expression of ZEB1, CDH2 and vimentin was significantly decreased in miR-708-3p-overexpressing cells at both the mRNA and protein levels compared to that in vector control cells. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.