General Information of the Molecule (ID: Mol01738)
Name
hsa-miR-708-3p ,Homo sapiens
Synonyms
microRNA 708
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CAACUAGACUGUGAGCUUCUAG
    Click to Show/Hide
Ensembl ID
ENSG00000211997
HGNC ID
HGNC:33654
Mature Accession
MIMAT0004927
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
MCF10A cells Breast Homo sapiens (Human) CVCL_0598
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Overexpression of miR-708-3p dramatically inhibits breast cancer cell lung metastasis and the expression of ZEB1, CDH2 and vimentin was significantly decreased in miR-708-3p-overexpressing cells at both the mRNA and protein levels compared to that in vector control cells.
References
Ref 1 MicroRNA-708-3p mediates metastasis and chemoresistance through inhibition of epithelial-to-mesenchymal transition in breast cancer. Cancer Sci. 2018 May;109(5):1404-1413. doi: 10.1111/cas.13588. Epub 2018 Apr 29.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.