General Information of the Molecule (ID: Mol01735)
Name
hsa-miR-874-3p ,Homo sapiens
Synonyms
microRNA 874
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CUGCCCUGGCCCGAGGGACCGA
    Click to Show/Hide
Ensembl ID
ENSG00000216009
HGNC ID
HGNC:33643
Mature Accession
MIMAT0004911
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Hippo signaling pathway Activation hsa04391
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Caspase-9 or 3 activity assays; Flow cytometric analysis
Mechanism Description Down-regulation of miR874-3p promotes chemotherapeutic resistance in colorectal cancer via inactivation of the Hippo signaling pathway. miR874-3p directly inhibited the expression of transcriptional co-activators YAP and TAZ of the Hippo signaling pathway, resulting in the inactivation of the TEAD transcription.
References
Ref 1 Downregulation of miR-874-3p promotes chemotherapeutic resistance in colorectal cancer via inactivation of the Hippo signaling pathway. Oncol Rep. 2017 Dec;38(6):3376-3386. doi: 10.3892/or.2017.6041. Epub 2017 Oct 17.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.