Molecule Information
General Information of the Molecule (ID: Mol01735)
Name |
hsa-miR-874-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 874
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
CUGCCCUGGCCCGAGGGACCGA
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [1] | |||
Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Hippo signaling pathway | Activation | hsa04391 | |
In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Caspase-9 or 3 activity assays; Flow cytometric analysis | |||
Mechanism Description | Down-regulation of miR874-3p promotes chemotherapeutic resistance in colorectal cancer via inactivation of the Hippo signaling pathway. miR874-3p directly inhibited the expression of transcriptional co-activators YAP and TAZ of the Hippo signaling pathway, resulting in the inactivation of the TEAD transcription. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.