Molecule Information
General Information of the Molecule (ID: Mol01735)
| Name |
hsa-miR-874-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 874
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
CUGCCCUGGCCCGAGGGACCGA
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [1] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Hippo signaling pathway | Activation | hsa04391 | |
| In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Caspase-9 or 3 activity assays; Flow cytometric analysis | |||
| Mechanism Description | Down-regulation of miR874-3p promotes chemotherapeutic resistance in colorectal cancer via inactivation of the Hippo signaling pathway. miR874-3p directly inhibited the expression of transcriptional co-activators YAP and TAZ of the Hippo signaling pathway, resulting in the inactivation of the TEAD transcription. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
