Molecule Information
General Information of the Molecule (ID: Mol01734)
Name |
hsa-miR-450b-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 450b
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UUUUGCAAUAUGUUCCUGAAUA
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [1] | |||
Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
HT-29 cells | Colon | Homo sapiens (Human) | CVCL_0320 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-450b-5p inhibited stemness and development of chemoresistance to 5-FU by targeting SOX2 in CRC cells. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.