Molecule Information

General Information of the Molecule (ID: Mol01734)

• Name: hsa-miR-450b-5p ,Homo sapiens
• Synonyms: microRNA 450b
• Molecule Type: Mature miRNA
• Sequence: UUUUGCAAUAUGUUCCUGAAUA
• Ensembl ID: ENSG00000216001
• HGNC ID: HGNC:33642
• Mature Accession: MIMAT0004909

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Testicular cancer [.] [1]

• Resistant Disease: Testicular cancer [.]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: RT-qPCR with "Low Density Array"
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Examining almost all known human micro-RNA species confirmed the miR-371-373 cluster as a promising target for explaining cisplatin resistance, potentially by counteracting wild-type P53 induced senescence or linking it with the potency to differentiate. Moreover, we describe for the first time an association of the up-regulation of micro-RNA species such as hsa-miR-512-3p/-515/-517/-518/-525 and down-regulation of hsa-miR-99a/-100/-145 with a cisplatin resistant phenotype in human germ cell tumors.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [2]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-450b-5p inhibited stemness and development of chemoresistance to 5-FU by targeting SOX2 in CRC cells.

References

• Ref 1: Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells. J Exp Clin Cancer Res. 2011 May 13;30(1):55. doi: 10.1186/1756-9966-30-55.
• Ref 2: miR-450b-5p Suppresses Stemness and the Development of Chemoresistance by Targeting SOX2 in Colorectal Cancer. DNA Cell Biol. 2016 May;35(5):249-56. doi: 10.1089/dna.2015.3120. Epub 2016 Feb 4.