General Information of the Molecule (ID: Mol01733)
Name
hsa-miR-298 ,Homo sapiens
Synonyms
microRNA 298
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AGCAGAAGCAGGGAGGUUCUCCCA
    Click to Show/Hide
Ensembl ID
ENSG00000216031
HGNC ID
HGNC:33634
Mature Accession
MIMAT0004901
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [1]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration
Northern blotting analysis
Experiment for
Drug Resistance
MTT assay
Mechanism Description Overexpression of miR-298 down-regulated P-gp expression, increasing nuclear accumulation of doxorubicin and cytotoxicity in doxorubicin-resistant breast cancer cells.
References
Ref 1 Increased expression of P-glycoprotein and doxorubicin chemoresistance of metastatic breast cancer is regulated by miR-298. Am J Pathol. 2012 Jun;180(6):2490-503. doi: 10.1016/j.ajpath.2012.02.024. Epub 2012 Apr 19.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.