Molecule Information

General Information of the Molecule (ID: Mol01733)

• Name: hsa-miR-298 ,Homo sapiens
• Synonyms: microRNA 298
• Molecule Type: Mature miRNA
• Sequence: AGCAGAAGCAGGGAGGUUCUCCCA
• Ensembl ID: ENSG00000216031
• HGNC ID: HGNC:33634
• Mature Accession: MIMAT0004901

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: Northern blotting analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR-298 down-regulated P-gp expression, increasing nuclear accumulation of doxorubicin and cytotoxicity in doxorubicin-resistant breast cancer cells.

References

• Ref 1: Increased expression of P-glycoprotein and doxorubicin chemoresistance of metastatic breast cancer is regulated by miR-298. Am J Pathol. 2012 Jun;180(6):2490-503. doi: 10.1016/j.ajpath.2012.02.024. Epub 2012 Apr 19.