Molecule Information
General Information of the Molecule (ID: Mol01729)
Name |
hsa-miR-589-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 589
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UGAGAACCACGUCUGCUCUGAG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [1] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | STAT3 signaling pathway | Activation | hsa04550 | |
In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
QGY-7703 cells | Liver | Homo sapiens (Human) | CVCL_6715 | |
SMMC7721 cells | Uterus | Homo sapiens (Human) | CVCL_0534 | |
97H cells | Liver | Homo sapiens (Human) | N.A. | |
PLC cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Flow cytometric analysis; Spheroid formation assay | |||
Mechanism Description | miR589-5p promotes the cancer stem cell characteristics and chemoresistance via targeting multiple negative regulators of STAT3 signaling pathway, including SOCS2, SOCS5, PTPN1 and PTPN11, leading to constitutive activation of STAT3 signaling. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.