General Information of the Molecule (ID: Mol01729)
Name
hsa-miR-589-5p ,Homo sapiens
Synonyms
microRNA 589
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGAGAACCACGUCUGCUCUGAG
    Click to Show/Hide
Ensembl ID
ENSG00000207973
HGNC ID
HGNC:32845
Mature Accession
MIMAT0004799
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation STAT3 signaling pathway Activation hsa04550
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
QGY-7703 cells Liver Homo sapiens (Human) CVCL_6715
SMMC7721 cells Uterus Homo sapiens (Human) CVCL_0534
97H cells Liver Homo sapiens (Human) N.A.
PLC cells Liver Homo sapiens (Human) CVCL_0485
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Flow cytometric analysis; Spheroid formation assay
Mechanism Description miR589-5p promotes the cancer stem cell characteristics and chemoresistance via targeting multiple negative regulators of STAT3 signaling pathway, including SOCS2, SOCS5, PTPN1 and PTPN11, leading to constitutive activation of STAT3 signaling.
References
Ref 1 Maintenance of stemness by miR-589-5p in hepatocellular carcinoma cells promotes chemoresistance via STAT3 signaling. Cancer Lett. 2018 Jun 1;423:113-126. doi: 10.1016/j.canlet.2017.11.031. Epub 2017 Nov 28.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.