Molecule Information
General Information of the Molecule (ID: Mol01726)
Name |
hsa-miR-509-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 509-1
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UACUGCAGACAGUGGCAAUCA
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Pancreatic cancer | [1] | |||
Sensitive Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
Sensitive Drug | Gemcitabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
Cell migration | Inhibition | hsa04670 | ||
Epithelial mesenchymal transition signaling pathway | Inhibition | hsa01521 | ||
TGF-beta signaling pathway | Inhibition | hsa04350 | ||
In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 | |
Su.86.86 cells | Pancreas | Homo sapiens (Human) | CVCL_3881 | |
CFPAC1 cells | Pancreas | Homo sapiens (Human) | CVCL_1119 | |
KMP3 cells | Pancreas | Homo sapiens (Human) | CVCL_8491 | |
KP4-4 cells | Pancreas | Homo sapiens (Human) | CVCL_Y142 | |
Panc1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
WST-8 assay; Crystal violet staining assay | |||
Mechanism Description | miR509-5p and miR1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer miR509-5p induced an MET phenotype by directly regulating VIM and HMGA2. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.