Molecule Information

General Information of the Molecule (ID: Mol01718)

• Name: hsa-miR-423-5p ,Homo sapiens
• Synonyms: microRNA 423
• Molecule Type: Mature miRNA
• Sequence: UGAGGGGCAGAGAGCGAGACUUU
• Ensembl ID: ENSG00000283935
• HGNC ID: HGNC:31880
• Mature Accession: MIMAT0004748

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [1]

• Resistant Disease: Glioblastoma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT/ERK signaling pathway; Activation; hsa04010
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vitro Model: N3 GBM cells; Brain; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: Cell-cycle assay
• Mechanism Description: miR-423-5p contributes to a malignant phenotype and temozolomide chemoresistance in glioblastomas.

Investigative Drug(s) 1 drug(s) in total

Apigenin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [2]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Apigenin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Bax/BCL2/caspase-3 signaling pathway; Activation; hsa04933
• Cell Pathway Regulation: Mitochondrial signaling pathway; Regulation; hsa04217
• In Vitro Model: CD133-positive cells; Brain; Homo sapiens (Human); CVCL_IR55
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Annexin V/PI apoptosis assay; Caspase-3 activity assay
• Mechanism Description: Retracted-miR423-5p knockdown enhances the sensitivity of glioma stem cells to apigenin through the mitochondrial pathway.

References

• Ref 1: miR-423-5p contributes to a malignant phenotype and temozolomide chemoresistance in glioblastomas. Neuro Oncol. 2017 Jan;19(1):55-65. doi: 10.1093/neuonc/now129. Epub 2016 Jul 28.
• Ref 2: miR-423-5p knockdown enhances the sensitivity of glioma stem cells to apigenin through the mitochondrial pathway. Tumour Biol. 2017 Apr;39(4):1010428317695526. doi: 10.1177/1010428317695526.