General Information of the Molecule (ID: Mol01718)
Name
hsa-miR-423-5p ,Homo sapiens
Synonyms
microRNA 423
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGAGGGGCAGAGAGCGAGACUUU
    Click to Show/Hide
Ensembl ID
ENSG00000283935
HGNC ID
HGNC:31880
Mature Accession
MIMAT0004748
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Temozolomide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [ICD-11: 2A00.02] [1]
Resistant Disease Glioblastoma [ICD-11: 2A00.02]
Resistant Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT/ERK signaling pathway Activation hsa04010
Cell invasion Activation hsa05200
Cell proliferation Activation hsa05200
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
N3 GBM cells Brain Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR
Experiment for
Drug Resistance
Cell-cycle assay
Mechanism Description miR-423-5p contributes to a malignant phenotype and temozolomide chemoresistance in glioblastomas.
Investigative Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Apigenin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioma [ICD-11: 2A00.1] [2]
Sensitive Disease Glioma [ICD-11: 2A00.1]
Sensitive Drug Apigenin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Bax/BCL2/caspase-3 signaling pathway Activation hsa04933
Mitochondrial signaling pathway Regulation N.A.
In Vitro Model CD133-positive cells Brain Homo sapiens (Human) CVCL_IR55
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Annexin V/PI apoptosis assay; Caspase-3 activity assay
Mechanism Description Retracted-miR423-5p knockdown enhances the sensitivity of glioma stem cells to apigenin through the mitochondrial pathway.
References
Ref 1 miR-423-5p contributes to a malignant phenotype and temozolomide chemoresistance in glioblastomas. Neuro Oncol. 2017 Jan;19(1):55-65. doi: 10.1093/neuonc/now129. Epub 2016 Jul 28.
Ref 2 miR-423-5p knockdown enhances the sensitivity of glioma stem cells to apigenin through the mitochondrial pathway. Tumour Biol. 2017 Apr;39(4):1010428317695526. doi: 10.1177/1010428317695526.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.