Molecule Information
General Information of the Molecule (ID: Mol01718)
| Name |
hsa-miR-423-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 423
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UGAGGGGCAGAGAGCGAGACUUU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioblastoma [ICD-11: 2A00.02] | [1] | |||
| Resistant Disease | Glioblastoma [ICD-11: 2A00.02] | |||
| Resistant Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | AKT/ERK signaling pathway | Activation | hsa04010 | |
| Cell invasion | Activation | hsa05200 | ||
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
| N3 GBM cells | Brain | Homo sapiens (Human) | N.A. | |
| Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
| Experiment for Drug Resistance |
Cell-cycle assay | |||
| Mechanism Description | miR-423-5p contributes to a malignant phenotype and temozolomide chemoresistance in glioblastomas. | |||
Investigative Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioma [ICD-11: 2A00.1] | [2] | |||
| Sensitive Disease | Glioma [ICD-11: 2A00.1] | |||
| Sensitive Drug | Apigenin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Bax/BCL2/caspase-3 signaling pathway | Activation | hsa04933 | |
| Mitochondrial signaling pathway | Regulation | N.A. | ||
| In Vitro Model | CD133-positive cells | Brain | Homo sapiens (Human) | CVCL_IR55 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Annexin V/PI apoptosis assay; Caspase-3 activity assay | |||
| Mechanism Description | Retracted-miR423-5p knockdown enhances the sensitivity of glioma stem cells to apigenin through the mitochondrial pathway. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
