Molecule Information

General Information of the Molecule (ID: Mol01716)

• Name: hsa-miR-331-5p ,Homo sapiens
• Synonyms: microRNA 331
• Molecule Type: Mature miRNA
• Sequence: CUAGGUAUGGUCCCAGGGAUCC
• Ensembl ID: ENSG00000199172
• HGNC ID: HGNC:31772
• Mature Accession: MIMAT0004700

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Leukemia [1]

• Resistant Disease: Leukemia [ICD-11: 2B33.6]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The expression of miR-331-5p and miR-27a was inversely correlated with MDR1 expression. Transfection of exogenous miR-27a or miR-331-5p, or a combination of these two miRNAs, down-regulated MDR1 and increased sensitivity of the k562-resistant cancer cells to DOX.

References

• Ref 1: Down-regulated miR-331-5p and miR-27a are associated with chemotherapy resistance and relapse in leukaemia. J Cell Mol Med. 2011 Oct;15(10):2164-75. doi: 10.1111/j.1582-4934.2010.01213.x.