Molecule Information
General Information of the Molecule (ID: Mol01716)
Name |
hsa-miR-331-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 331
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
CUAGGUAUGGUCCCAGGGAUCC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Leukemia | [1] | |||
Resistant Disease | Leukemia [ICD-11: 2B33.6] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | The expression of miR-331-5p and miR-27a was inversely correlated with MDR1 expression. Transfection of exogenous miR-27a or miR-331-5p, or a combination of these two miRNAs, down-regulated MDR1 and increased sensitivity of the k562-resistant cancer cells to DOX. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.