Molecule Information
General Information of the Molecule (ID: Mol01716)
| Name |
hsa-miR-331-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 331
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
CUAGGUAUGGUCCCAGGGAUCC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Leukemia [ICD-11: 2B33.6] | [1] | |||
| Resistant Disease | Leukemia [ICD-11: 2B33.6] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The expression of miR-331-5p and miR-27a was inversely correlated with MDR1 expression. Transfection of exogenous miR-27a or miR-331-5p, or a combination of these two miRNAs, down-regulated MDR1 and increased sensitivity of the k562-resistant cancer cells to DOX. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
