Molecule Information
General Information of the Molecule (ID: Mol01715)
Name |
hsa-miR-340-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 340
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UUAUAAAGCAAUGAGACUGAUU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [1] | |||
Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
PI3K/AKT/mTOR signaling pathway | Activation | hsa04151 | ||
In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | OIP5-AS1 regulates cisplatin resistance by activating the PI3k/AkT/mTOR signaling pathway. | |||
Disease Class: Hepatocellular carcinoma | [2] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell viability | Activation | hsa05200 | ||
NRAL/miR340-5p/Nrf2 signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
SMMC7721 cells | Uterus | Homo sapiens (Human) | CVCL_0534 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | There is mutual inhibition between NRAL and mir-340-5p and NRAL directly interacts with miR-340-5p to up-regulate the expression of its target, Nrf2, to mediate cisplatin-resistant HCC phenotypes. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [3] | |||
Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
MG63/CDDP cells | Bone | Homo sapiens (Human) | CVCL_0426 | |
SAOS-2/CDDP cells | Bone | Homo sapiens (Human) | CVCL_0548 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Annexin V-FITC apoptosis assay | |||
Mechanism Description | microRNA-340-5p modulates cisplatin resistance by targeting LPAATbeta in osteosarcoma. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [4] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Docetaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell proliferation | Inhibition | hsa05200 | ||
Wnt/Beta-catenin signaling pathway | Inhibition | hsa04310 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
ZR75-1 cells | Breast | Homo sapiens (Human) | CVCL_0588 | |
BT549 cells | Breast | Homo sapiens (Human) | CVCL_1092 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | Overexpressed miR-340-5p inhibited cell proliferation and drug resistance with increased apoptosis of breast cancer cells through down-regulating LGR5 expression via Wnt/beta-catenin pathway. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.