Molecule Information
General Information of the Molecule (ID: Mol01715)
| Name |
hsa-miR-340-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 340
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UUAUAAAGCAAUGAGACUGAUU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [1] | |||
| Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| PI3K/AKT/mTOR signaling pathway | Activation | hsa04151 | ||
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | OIP5-AS1 regulates cisplatin resistance by activating the PI3k/AkT/mTOR signaling pathway. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [2] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell viability | Activation | hsa05200 | ||
| NRAL/miR340-5p/Nrf2 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| SMMC7721 cells | Uterus | Homo sapiens (Human) | CVCL_0534 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | There is mutual inhibition between NRAL and mir-340-5p and NRAL directly interacts with miR-340-5p to up-regulate the expression of its target, Nrf2, to mediate cisplatin-resistant HCC phenotypes. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [3] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
| MG63/CDDP cells | Bone | Homo sapiens (Human) | CVCL_0426 | |
| SAOS-2/CDDP cells | Bone | Homo sapiens (Human) | CVCL_0548 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Annexin V-FITC apoptosis assay | |||
| Mechanism Description | microRNA-340-5p modulates cisplatin resistance by targeting LPAATbeta in osteosarcoma. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [4] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Docetaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| Wnt/Beta-catenin signaling pathway | Inhibition | hsa04310 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| ZR75-1 cells | Breast | Homo sapiens (Human) | CVCL_0588 | |
| BT549 cells | Breast | Homo sapiens (Human) | CVCL_1092 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | Overexpressed miR-340-5p inhibited cell proliferation and drug resistance with increased apoptosis of breast cancer cells through down-regulating LGR5 expression via Wnt/beta-catenin pathway. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
