General Information of the Molecule (ID: Mol01714)
Name
hsa-miR-296-3p ,Homo sapiens
Synonyms
microRNA 296
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
GAGGGUUGGGUGGAGGCUCUCC
    Click to Show/Hide
Ensembl ID
ENSG00000284040
HGNC ID
HGNC:31617
Mature Accession
MIMAT0004679
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Lung cancer [1]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model Calu3 cells Lung Homo sapiens (Human) CVCL_0609
A549 cells Lung Homo sapiens (Human) CVCL_0023
SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
HCC827 cells Lung Homo sapiens (Human) CVCL_2063
NCI-H358 cells Lung Homo sapiens (Human) CVCL_1559
H157 cells Lung Homo sapiens (Human) CVCL_2458
D6 cells Lung Homo sapiens (Human) N.A.
LAX cells Lung Homo sapiens (Human) N.A.
LTEP-2 cells Lung Homo sapiens (Human) CVCL_6929
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR296-3p inhibited NSCLC cell proliferation, enhance the drug resistance, and apoptosis. Data of luciferase reporter assays demonstrated that the CX3CR1 gene was a direct regulator of tumorsuppressive miR296-3p. Moreover, overexpressed CX3CR1 was confirmed in NSCLC clinical specimens. Inhibition of CX3CR1 could inhibit cancer cellular survival and increase chemotherapy sensitivity. There was a negative relationship between miR296-3p and CX3CR1 expression in NSCLC tissues.
Etoposide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [2]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U251AR cells Brain Homo sapiens (Human) CVCL_1G29
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description EAG1 channel might be involved in cell-cycle progression of tumour cells because a significant reduction in the proliferation of tumour cell lines could be achieved by inhibiting EAG1 expression using antisense oligonucleotides. Ectopic expression of miR-296-3p reduced EAG1 expression and suppressed cell proliferation drug resistance.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Lung cancer [1]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model Calu3 cells Lung Homo sapiens (Human) CVCL_0609
A549 cells Lung Homo sapiens (Human) CVCL_0023
SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
HCC827 cells Lung Homo sapiens (Human) CVCL_2063
NCI-H358 cells Lung Homo sapiens (Human) CVCL_1559
H157 cells Lung Homo sapiens (Human) CVCL_2458
D6 cells Lung Homo sapiens (Human) N.A.
LAX cells Lung Homo sapiens (Human) N.A.
LTEP-2 cells Lung Homo sapiens (Human) CVCL_6929
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR296-3p inhibited NSCLC cell proliferation, enhance the drug resistance, and apoptosis. Data of luciferase reporter assays demonstrated that the CX3CR1 gene was a direct regulator of tumorsuppressive miR296-3p. Moreover, overexpressed CX3CR1 was confirmed in NSCLC clinical specimens. Inhibition of CX3CR1 could inhibit cancer cellular survival and increase chemotherapy sensitivity. There was a negative relationship between miR296-3p and CX3CR1 expression in NSCLC tissues.
Imatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [2]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
Sensitive Drug Imatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U251AR cells Brain Homo sapiens (Human) CVCL_1G29
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description EAG1 channel might be involved in cell-cycle progression of tumour cells because a significant reduction in the proliferation of tumour cell lines could be achieved by inhibiting EAG1 expression using antisense oligonucleotides. Ectopic expression of miR-296-3p reduced EAG1 expression and suppressed cell proliferation drug resistance.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Lung cancer [1]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model Calu3 cells Lung Homo sapiens (Human) CVCL_0609
A549 cells Lung Homo sapiens (Human) CVCL_0023
SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
HCC827 cells Lung Homo sapiens (Human) CVCL_2063
NCI-H358 cells Lung Homo sapiens (Human) CVCL_1559
H157 cells Lung Homo sapiens (Human) CVCL_2458
D6 cells Lung Homo sapiens (Human) N.A.
LAX cells Lung Homo sapiens (Human) N.A.
LTEP-2 cells Lung Homo sapiens (Human) CVCL_6929
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR296-3p inhibited NSCLC cell proliferation, enhance the drug resistance, and apoptosis. Data of luciferase reporter assays demonstrated that the CX3CR1 gene was a direct regulator of tumorsuppressive miR296-3p. Moreover, overexpressed CX3CR1 was confirmed in NSCLC clinical specimens. Inhibition of CX3CR1 could inhibit cancer cellular survival and increase chemotherapy sensitivity. There was a negative relationship between miR296-3p and CX3CR1 expression in NSCLC tissues.
Temozolomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [2]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U251AR cells Brain Homo sapiens (Human) CVCL_1G29
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description EAG1 channel might be involved in cell-cycle progression of tumour cells because a significant reduction in the proliferation of tumour cell lines could be achieved by inhibiting EAG1 expression using antisense oligonucleotides. Ectopic expression of miR-296-3p reduced EAG1 expression and suppressed cell proliferation drug resistance.
References
Ref 1 miRNA-296-3p modulates chemosensitivity of lung cancer cells by targeting CX3CR1. Am J Transl Res. 2016 Apr 15;8(4):1848-56. eCollection 2016.
Ref 2 MiR-296-3p regulates cell growth and multi-drug resistance of human glioblastoma by targeting ether-a-go-go (EAG1). Eur J Cancer. 2013 Feb;49(3):710-24. doi: 10.1016/j.ejca.2012.08.020. Epub 2012 Sep 18.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.