Molecule Information
General Information of the Molecule (ID: Mol01714)
Name |
hsa-miR-296-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 296
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
GAGGGUUGGGUGGAGGCUCUCC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung cancer | [1] | |||
Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | Calu3 cells | Lung | Homo sapiens (Human) | CVCL_0609 |
A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
SPC-A1 cells | Lung | Homo sapiens (Human) | CVCL_6955 | |
HCC827 cells | Lung | Homo sapiens (Human) | CVCL_2063 | |
NCI-H358 cells | Lung | Homo sapiens (Human) | CVCL_1559 | |
H157 cells | Lung | Homo sapiens (Human) | CVCL_2458 | |
D6 cells | Lung | Homo sapiens (Human) | N.A. | |
LAX cells | Lung | Homo sapiens (Human) | N.A. | |
LTEP-2 cells | Lung | Homo sapiens (Human) | CVCL_6929 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | miR296-3p inhibited NSCLC cell proliferation, enhance the drug resistance, and apoptosis. Data of luciferase reporter assays demonstrated that the CX3CR1 gene was a direct regulator of tumorsuppressive miR296-3p. Moreover, overexpressed CX3CR1 was confirmed in NSCLC clinical specimens. Inhibition of CX3CR1 could inhibit cancer cellular survival and increase chemotherapy sensitivity. There was a negative relationship between miR296-3p and CX3CR1 expression in NSCLC tissues. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioblastoma | [2] | |||
Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
Sensitive Drug | Etoposide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
U251AR cells | Brain | Homo sapiens (Human) | CVCL_1G29 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | EAG1 channel might be involved in cell-cycle progression of tumour cells because a significant reduction in the proliferation of tumour cell lines could be achieved by inhibiting EAG1 expression using antisense oligonucleotides. Ectopic expression of miR-296-3p reduced EAG1 expression and suppressed cell proliferation drug resistance. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung cancer | [1] | |||
Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | Calu3 cells | Lung | Homo sapiens (Human) | CVCL_0609 |
A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
SPC-A1 cells | Lung | Homo sapiens (Human) | CVCL_6955 | |
HCC827 cells | Lung | Homo sapiens (Human) | CVCL_2063 | |
NCI-H358 cells | Lung | Homo sapiens (Human) | CVCL_1559 | |
H157 cells | Lung | Homo sapiens (Human) | CVCL_2458 | |
D6 cells | Lung | Homo sapiens (Human) | N.A. | |
LAX cells | Lung | Homo sapiens (Human) | N.A. | |
LTEP-2 cells | Lung | Homo sapiens (Human) | CVCL_6929 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | miR296-3p inhibited NSCLC cell proliferation, enhance the drug resistance, and apoptosis. Data of luciferase reporter assays demonstrated that the CX3CR1 gene was a direct regulator of tumorsuppressive miR296-3p. Moreover, overexpressed CX3CR1 was confirmed in NSCLC clinical specimens. Inhibition of CX3CR1 could inhibit cancer cellular survival and increase chemotherapy sensitivity. There was a negative relationship between miR296-3p and CX3CR1 expression in NSCLC tissues. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioblastoma | [2] | |||
Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
Sensitive Drug | Imatinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
U251AR cells | Brain | Homo sapiens (Human) | CVCL_1G29 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | EAG1 channel might be involved in cell-cycle progression of tumour cells because a significant reduction in the proliferation of tumour cell lines could be achieved by inhibiting EAG1 expression using antisense oligonucleotides. Ectopic expression of miR-296-3p reduced EAG1 expression and suppressed cell proliferation drug resistance. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung cancer | [1] | |||
Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | Calu3 cells | Lung | Homo sapiens (Human) | CVCL_0609 |
A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
SPC-A1 cells | Lung | Homo sapiens (Human) | CVCL_6955 | |
HCC827 cells | Lung | Homo sapiens (Human) | CVCL_2063 | |
NCI-H358 cells | Lung | Homo sapiens (Human) | CVCL_1559 | |
H157 cells | Lung | Homo sapiens (Human) | CVCL_2458 | |
D6 cells | Lung | Homo sapiens (Human) | N.A. | |
LAX cells | Lung | Homo sapiens (Human) | N.A. | |
LTEP-2 cells | Lung | Homo sapiens (Human) | CVCL_6929 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | miR296-3p inhibited NSCLC cell proliferation, enhance the drug resistance, and apoptosis. Data of luciferase reporter assays demonstrated that the CX3CR1 gene was a direct regulator of tumorsuppressive miR296-3p. Moreover, overexpressed CX3CR1 was confirmed in NSCLC clinical specimens. Inhibition of CX3CR1 could inhibit cancer cellular survival and increase chemotherapy sensitivity. There was a negative relationship between miR296-3p and CX3CR1 expression in NSCLC tissues. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioblastoma | [2] | |||
Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
Sensitive Drug | Temozolomide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
U251AR cells | Brain | Homo sapiens (Human) | CVCL_1G29 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | EAG1 channel might be involved in cell-cycle progression of tumour cells because a significant reduction in the proliferation of tumour cell lines could be achieved by inhibiting EAG1 expression using antisense oligonucleotides. Ectopic expression of miR-296-3p reduced EAG1 expression and suppressed cell proliferation drug resistance. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.